AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          <-----------TGA1
          <-----------HVH21                                  <---------PCF2
         <---------ANAC55(2)                             <-------MYC3
         <---------bZIP60(1)                             <-------MYC2
         --------->bZIP60(2)                             ------->MYC3
         --------->ANAC55(2)                             ------->MYC2
         --------->ANAC46                                ------->PIF5
         =============================================bZIP_DOF
         --------->ANAC58                                <-------PIF5
         --------->ANAC58                               <---------ANAC58
         --------->O2                                   --------->ALFIN1
         --------->TGA1a                                -------------->OsCBT
         <---------O2                                   --------->TGA1a                           <-
         --------->bZIP60(1)                            <---------TGA1a                          ---
         <---------TGA1a                             <-------MYC3                                ---
        <-----------bZIP910(1)                       <-------MYC2       <------MYB83            <---
        <-----------STF1                             ------->MYC3       <---------HSFB2a(1)     ----
     <-----------HVH21                               ------->MYC2       <------MYB46(1)      <------
   ------>ZmHOX2a(2)                                --------->ANAC58    <---------HSFC1(2)  --------
  --------->At4g35610                               --------->ANAC58 <------ZmHOX2a(1)     <--------
  <---------At4g35610                             --------->KAN1 <---------ANAC46          ---------
 --------->GATA12                              ----------->HVH21<------NtERF2              ---------
 --------->ARR11(3)                         --------->DAG2 <---------MYB46(3)          <---------LBD16
 --------->ARR14(2)                   <------ZmHOX2a(1) <---------ANAC46--------->HSFC1(2) <--------
 <---------ARR11(3)   <---------HSFB2a(2)  =======================bZIP_DOF          <-----------HVH21
 <---------GATA12     --------->HSFB2a(2)  ---------->DOF2--------->ALFIN1         --------->DEAR3(1)
------>YAB1--------->TGA2(2)         --------->DOF5.7(1)<---------ANAC58--------->HSFB2a(1)---------
--ARR10<---------ALFIN1   --------->DOF5.7(1)----------->GT1 <-----------HVH21  <---------ALFIN1<---
 
gcatgatctgccacgtcatcaaactcgagaagagcgtcgaaggagggaaagtgacacgcgcgtgggtcgcgaggaaggttctcacaccgtctcggaacgg  12123200
                                  <------NtERF2
                                 --------->HSFB2a(2)
                                 <---------HSFB2a(2)
                               <------NtERF2
                               <---------MYB52(1)
                              ------>NtERF2
                              <---------SPL7(1)
                             --------->RAP2.3(3)                  <---------RVE1(2)
                             --------->ATERF1(2)                  <---------GLK1(2)
                             <---------ATERF1(2)            --------->ZAT2
                             --------->DEAR3(1)             --------->At4g35610
                            --------->RAP2.3(1)             ----------->RAV1(2)
                            --------->ATERF1(1)             <---------At4g35610
       <------NtERF2       ------>NtERF2                    <---------ZAT2
---------->DOF2            --------->LBD16                  ======================RAV
-----NtERF2                <---------ATERF1(1)            ========================RAV
--->NtERF2                --------->ANAC46                <-----------RAV1(2)
------>RAP2.6(2)          --------->DEAR3(1)             <------ZmHOX2a(2)
------ATERF1(2)          <---------LBD16                <---------GATA12      --------->REM1(1)
----->ATERF1(2)        ------>ZmHOX2a(2)                --------->ARR11(3)    --------->ANAC46
---DEAR3(1)           <---------GLK1(1)                 --------->RVE1(2)     --------->ANAC58
->SPL7(1)            <---------ARR11(3)                 <---------ARR11(3)    --------->ANAC58
-ARR11(2)            <---------GATA12                 --------->ICU4   <-------GAMYB               -
>ARR11(2)            --------->GATA12                 <---------YAB5  <-----------RAV1(1)          -
>ARR14(2)            --------->ARR11(3)               --------->DOF5.7(1)     <---------ALFIN1    <-
-ARR14(2)          --------->WRKY12              --------->YAB1  --------->KAN1------>NtERF2      --
>MYB52(1)         <---------MYB52(1)---------->DOF2 ---------->DOF2--------->GLK1(2)            <---
------DEAR3(1)   <-------GAMYB<-----------HVH21  ----------->GT1----------->ARR10            <------
 
cggcaaagtcgtcgactcgccgttgatctccgccgtcgggaaagtagagaaatcgtaaagatcagctgagattctgttgctacgcctcgctcgcttcgtc  12123300
                                                         <---------AHL25(1)
         <-------TEIL                                    <---------AHL25(3)
        <---------MYB52(1)                               --------->AHL20(2)
   <---------ALFIN1                                    <---------WOX13(2)
   --------->AtMYB61                                   --------->WOX13(2)
  --------->MYB46(3)                                 --------->AHL20(2)
-------->ANAC58                                     --------->AHL20(2)           --------->CCA1(2)
-------->ANAC58      ----------->HVH21          <---------ALFIN1                --------->ARR11(3)
--------TOE1(2)  ------>NtERF2               <---------ETT(1)       <---------KAN1<-------TEIL -----
------->SPL7(1) --------->DREB2C(2)          --------->ANAC46     --------->YAB1--------->ARR11(1) <
------SPL7(1)   --------->DEAR3(1)         <-----------GT1  --------->ZAT6   <---------TOE2(3)<-----
-----HVH21      --------->ANAC46       <---------DOF5.7(1)<---------AHL25(3)---------->DOF2   <-----
 
gcacgaccaccgttcatcaccgccatgactgtgtaacaagggttttttccgacacttaaattaaaactagaataagagttaaagatacagagagagagat  12123400
                                                                    <---------GLK1(2)
                                                                    --------->ARR11(3)
                                                                    <---------RVE1(2)
                                                                    <---------ARR11(3)
                                                                   <---------RVE1(1)
       <-------TEIL                                            <------NtERF2
      --------->CCA1(2)                                 <---------ICU4  <-----------GT1
     <---------RVE1(2)       ----------->GT1 <------ZmHOX2a(1)--------->LBD16                 <-----
---->CCA1(2)                --------->DOF5.7(1)   ----------->GT1 ----------->ARR10           ------
---------TOE2(3)            --------->DAG2 <---------TOE1(3) <---------ANAC46                 <-----
----RVE1(2)   --------->ALFIN1             <---------TOE2(3)<---------LBD16      ---------->DOF2
----GATA12   <------ZmHOX2a(1)         <----------DOF2 --------->ICU4  <-----------GT1       <------ZmHOX2a(1)
 
ttgagatagatacagaggaggggagagagagaaggtgaagaggtttaaggagagagtaattttggcggagagattttccctctcaaaagttttggaggat  12123500
                                           <---------YAB1
                                           ----------->HVH21
                                    -------->ZAP1
                                  <---------WRKY18(1)                              <---------DOF5.7(1)
                                 ----------->HVH21                      <---------DOF5.7(1)
         <---------ANAC46        --------->WRKY38(1)                   <----------DOF2
       <---------LBD16           --------->WRKY12                 <---------At4g35610  <-----------GT1
<---------TOE1(3)              <---------ANAC58                   --------->KAN1   <----------DOF2
<---------TOE2(3)              >>>>>>>>>>WRKY18                  <-------TEIL   <-----------GT1  ---
----ARR11(3)                   <---------ANAC58                 <--------P <---------AHL20(2)   <---
--->ARR14(2)                 <---------WRKY18(1)       *TSS   <------MYB83--------->AHL25(3)    <---
----ARR14(2)          ---------->DOF2    <---------At4g35610  <------MYB46(1)  <-----------GT1  ----
 
tttagggttttggggggtattgactaaaagcttgacttgaccgcttctgatgggggaaggaaggaaggtagatgctttttattttccttttctctactca  12123600
                 --------->PCF2
                <---------PCF2
                --------->TCP20
                <---------PCF5
                --------->ARR14(2)
                <---------ARR14(2)
               <------MYB46(1)
               <------MYB83                <---------ARR14(2)      <---------DOF5.7(1)
               <---------TCP15(2)          --------->ARR11(2)      <----------DOF2
              <---------MYB46(3)           <---------ARR11(2)     <---------DAG2
    --------->HSFB2a(2)                    --------->ARR14(2)     <---------DOF5.7(1)
    <---------HSFB2a(2)                   <-------GAMYB         ------>NtERF2
   <---------LBD16              <---------ARR14(2)             --------->ANAC46
   <---------ANAC46             --------->ARR14(2)             --------->ANAC58
  <---------LBD16<---------TCP15(1)      <---------DEAR3(2)    --------->ANAC58       <-----------GT1
------------>AGL15      --------->KAN1   <---------MYB46(3)  <---------ALFIN1  <---------AHL20(2)
--------------AGL1   ----------->RAV1(2)<---------RAP2.6(2) <---------REM1(2) --------->AHL25(3)
--------------AG--------->TCP15(1)      <---------DEAR3(1)<-----------GT1 <------------------------ANAC81
-------->CBF --------->ALFIN1  --------->KAN1        <----------DOF2<---------DOF5.7(1)
 
ccaatttcgggagagagtgggtccccctgattccaaattcgaggcggtttcgatttctttttctccacgcctttttttgtttttatttgtttccctattt  12123700
                                                                                         <---------ARR14(2)
                                      <---------DOF5.7(1)         --------->WOX13(2)     --------->ARR11(2)
                                      <----------DOF2--------->AHL20(2)                  <---------ARR11(2)
                                      ------>ZmHOX2a(1)      --------->RVE1(2)     --------->RVE1(2)
                             --------->WOX13(2)    <---------WOX13(2)       --------->ARR11(2)
                         <---------At4g35610       --------->WOX13(2)       <---------ARR11(2)    --
                         --------->At4g35610 ---------->ID1---------->DOF2  --------->RVE1(2)   <---
         <---------AHL20(2)  <---------WOX13(2) ------>ZmHOX2a(1) <---------WOX13(2)     --------->ARR14(2)
       <----------DOF2  --------->MYB59<---------DOF5.7(1)--------->AtMYB61------>ZmHOX2a(1)<-------
 
tgttcgatttcttttatttcaataagttagctaattaagtccttttttgtcctcaataaaaccaaagctaattaagtcctatccattatccagttccgat  12123800
                                                    --------->YAB5
                                                   --------->ICU4                       --------->WOX13(2)
                                                   <---------ATHB12                    --------->KAN1
                                     <------ZmHOX2a(2)                                 --------->ATHB12
                                     --------->GLK1(1)                                --------->AHL20(2)
                                     <---------GLK1(1)                                <---------AHL12(1)
                                    --------->RVE1(2)                                 --------->AHL12(1)
                          --------->ANAC46   --------->GATA12    <---------WOX13(2)--------->ATHB12
                         -------->P --------->GATA12--------->YAB1          --------->ANAC46   -----
                     --------->GLK1(2)       <---------GATA12  --------->AHL20(2)  <--------ATHB1
                     <-----------ARR10------>ZmHOX2a(2)        <---------YAB1     --------->ICU4
               <---------HSFB2a(2)  <---------GATA12<--------ATHB1 <---------AHL20(2) <---------AHL20(2)
 <---------ALFIN1  --------->KAN1   <---------AGP1 <---------YAB5--------->WOX13(2)--------->YAB5
--------->HVH21--------->HSFB2a(2)  --------->ARR11(3)         --------->AHL25(1) <---------ATHB12
------KAN1   <---------ANAC46       <---------ARR11(3)<---------YAB1 <---------TOE2(3)--------->AHL25(3)
--YAB1    <---------MYB52(1)     --------->YAB1<-------TEIL    <---------AHL20(2) <---------YAB5
 
tgtgacaccttctgttttgtagaaattctaccccaataagatctctcagattcaatgatttttgttttaattaagttataggccaatgatttattagcaa  12123900
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                          <---------AHL25(3)
                                                                                          --------->AHL20(3)
                                                                                          --------->AHL12(3)
                                                                                          <---------AHL20(2)
                                                                                          <---------AHL20(3)
                                                                                          --------->AHL25(1)
                                                                                          --------->AHL25(3)
                                                                                          <---------AHL25(2)
                                                                                          --------->AHL25(2)
                                                                                          <---------AHL25(1)
                                                                                        --------->AHL12(2)
                                                                                        <---------AHL12(2)
                                                                                       <---------AHL12(2)
                                                                                       --------->AHL20(1)
                                                                                       <---------AHL12(3)
                                                                                       <---------AHL25(3)
                                                                                       <---------AHL25(2)
                                                                                       --------->AHL25(2)
                                                                                       --------->AHL20(3)
                                                                                       <---------AHL20(3)
                                                                                      <---------AHL25(3)
                                                                                      <---------AHL25(1)
                                                                                      --------->AHL25(2)
                                                                                      <---------AHL25(2)
                                                                                      --------->AHL25(3)
                                                                                      --------->AHL25(1)
                                                                                      <---------AHL12(3)
                                                                                      <---------AHL12(1)
                                                                                      --------->AHL12(1)
                                                                                      --------->AHL20(2)
                                                                                      <---------AHL20(2)
                                                                                      --------->AHL12(3)
                                                                                     --------->AHL12(1)
                                                                                     --------->AHL25(2)
                                                                                     <---------AHL25(2)
                                                                                     --------->AHL25(3)
                                                                                     --------->AHL25(1)
                                                                                     --------->AHL12(3)
                                                                                     <---------AHL12(1)
                                                                                     <---------AHL20(1)
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL20(2)
                                                                                     <---------AHL25(1)
                                                         <---------AHL20(3)         --------->AHL12(2)
                                                         <---------AHL20(2)        --------->AHL12(2)
                        --------->WRKY12                 --------->AHL20(3)     --------->TOE2(3)
                        ----------->HVH21    <---------GLK1(1)            <-----------GT1 --------->AHL20(2)
                  --------->ANAC58          <---------ARR11(3)          <---------WOX13(2)<---------AHL20(1)
                  --------->ANAC58          --------->ARR11(3) --------->WOX13(2) --------->AHL20(2)
                  --------->ANAC46--------->AHL20(2)     --------->AHL20(2)  ----------->RAV1(1)  <-
           <---------AHL25(3)  <---------WOX13(2)<----------DOF2   <---------TOE2(3)<---------AHL12(2)
----->DOF2--------->AHL20(2)  ----------->GT1--------->GLK1(1) <---------WOX13(2) <---------AHL25(3)
 
aagtccaaaacaaataaaaacacaccactgacccagttaaaatataagatttctttctatttttttagttaagaaaattacaacataaattattttattt  12124000
                             --------->RVE1(2)
                          --------->AHL12(2)
                          <---------AHL12(2)
                         <---------AHL20(2)
                        <---------AHL20(2)
                        --------->AHL25(3)
                        --------->AHL20(2)
                       --------->AHL12(2)
                       <---------AHL12(2)
                      --------->AHL12(2)
                      <---------AHL12(2)
                     <---------AHL20(2)
                     --------->AHL20(2)
                     --------->AHL12(3)
                     --------->AHL25(1)
                     <---------AHL12(3)                      --------->AHL12(1)
                     --------->AHL25(2)                      <---------AHL12(1)
                     <---------AHL25(1)                      --------->KAN1
                     --------->AHL25(3)                     --------->AHL20(3)
                     <---------AHL25(3)                     --------->AHL20(1)
                     --------->AHL12(1)                     --------->AHL25(2)
                     <---------AHL12(1)                     <---------AHL25(2)
                    <---------AHL20(2)                      --------->AHL12(1)
                    --------->AHL12(3)                      <---------AHL12(1)
                    --------->AHL20(2)                      <---------AHL20(3)
                    --------->AHL25(1)                      --------->ARR11(3)
                    --------->AHL12(1)                      <---------ARR11(3)
---->AHL20(3)       <---------AHL20(1)                     --------->AHL12(2)
-----AHL20(2)       <---------AHL25(1)                     <---------AHL12(2)
---->AHL12(3)       --------->AHL25(3)                   <---------AHL25(2)
-----AHL20(1)       <---------AHL12(1)                   --------->AHL25(2)
-----AHL20(3)       <---------AHL25(2)                   <---------AHL20(3)
---->AHL25(1)       --------->AHL25(2)     <---------TOE2(3)<---------AHL20(1)
-----AHL25(3)      <---------AHL12(2)      <---------YAB1--------->AHL25(1)
---->AHL25(3)      --------->AHL12(2)  --------->YAB1    <---------AHL25(1)             --------->YAB1
-----AHL25(2)     --------->AHL12(2) <---------YAB1      --------->AHL25(3)            <---------YAB5
-----AHL25(1)    <---------AHL25(3) --------->AHL12(2)   --------->AHL20(3) <---------ZAT2
---->AHL25(2)    --------->AHL20(2)<--------HAHB4        --------->AHL20(2) --------->At4g35610
---->AHL20(2)  --------->TOE2(3)   --------->YAB1        <---------AHL20(2) --------->ZAT2  --------
--------YAB1----------->RAV1(1)   <---------YAB1 <---------TOE2(3)          <---------At4g35610
 
tatttttgtcagaaacaacataaattatttattatctattattaataagattaatgtgaataaaatattcgattagttcagcttggattaagcatactca  12124100
<- Previous    Next ->

AGI:  At1g33415.1   
Description:  other RNA
Range:  from: 12118972    to: 12126573    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g33420.1   
Description:  PHD finger family protein. Identical to PHD finger protein At1g33420 [Arabidopsis Thaliana] (GB:Q9C810); similar to MMD1 (MALE MEIOCYTE DEATH 1), DNA binding [Arabidopsis thaliana] (TAIR:AT1G66170.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO67097.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, PHD-type; (InterPro:IPR001965); contains InterPro domain Zinc finger, FYVE/PHD-type; (InterPro:IPR011011)
Range:  from: 12120866    to: 12123556    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version