AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                       <----------DOF2
                                                                       <---------DOF5.7(1)
                                                      <----------DOF2 <---------DOF5.7(1)
                                                   <---------ARR11(3) <---------DAG2
                          --------->YAB1           --------->ARR11(3) --------->TOE2(3)
                    --------->YAB5        --------->TOE2(3)        <-----------GT1             -----
                    --------->RVE1(2)   ------->TEIL <---------DOF5.7(1)                       <----
--DOF2       <---------TOE2(3)      <---------------AtSPL8      <---------REM1(1)  <------ZmHOX2a(1)
 
actcaaaacaagtattaaggcaatctctatgatgttttgtaagtaccttgaagaggtcttttgtaagttgtaaccttttttatgtaggagaagaatcaca  11681300
                                                                           ----------->HVH21
                                                                         <---------bZIP60(1)
                                                                         <---------bZIP60(2)
                                                                         --------->bZIP60(1)
                                                                      <---------YAB5
                                                                      --------->ICU4
                             <---------------AGL15                <---------YAB1
                             --------------->AGL15                <---------AHL20(2)
                            <-----------------AGL1                <---------AHL12(3)
    <----------DOF2         ----------------->AGL3                <---------AHL20(3)
   <---------DAG2           ----------------->AG                 --------->TOE2(3)
   <---------DOF5.7(1)   <----------DOF2         <-----------RAV1(1) <---------TOE2(3)
<-----------GT1     --------->KAN1               <---------MYB46(3) --------->YAB1
---->GATA12       <---------ANAC58       <---------DAG2          --------->YAB1    <---------ATHB12
-----GATA12       <---------ANAC58       <----------DOF2       --------->ICU4     --------->RVE1(2)-
 
tcttcaccttttgagtttttgacttgttctttccaaaatttgcacttttcaattgttgcaatggccaatattaatgatgtgacccaatctatttgtatag  11681400
                                                              <---------DOF5.7(1)
                                                             =======================================
                                                             <----------DOF2
                                                             <---------------AGL15
                                                             --------------->AGL15
                                                        --------->KAN1
                                                       --------->AHL20(3)
                                                       <---------AHL20(3)
                                                       --------->AHL20(2)
                                                       <---------AHL20(2)
                                                       <---------AHL20(1)
                                                       --------->ARR11(3)
                                                       --------->AHL12(1)
                                                       <---------AHL12(1)
                                                       --------->AHL20(1)            <--------HAHB4
                                                       --------->AHL25(3)            --------->ATHB51
                                                       --------->AHL25(1)            <---------ICU4
                                                       <---------ARR11(3)           --------->ICU4
                                                       <---------AHL25(3)           <---------YAB1
                                                       <---------AHL25(2)         --------->YAB1
                                                       <---------AHL25(1)        <-------TEIL
                                                       --------->AHL25(2)  <---------AHL25(3)
                                                      --------->AHL12(2)   <---------AHL20(2)
                                                      --------->AHL12(1)   --------->AHL25(3)
                                                      <---------AHL12(1)  <---------AHL12(2)
                                                      <---------AHL12(2)  <---------AHL12(3)
                                                      --------->AHL20(2) --------->AHL12(2)
                                                      <---------AHL12(3) <---------AHL12(2) --------
                                              <---------At4g35610  --------->HSFB2a(2)<---------WOX13(2)
                                    --------->DAG2    --------->AHL12(3)--------->AHL12(1) <--------
                        --------->AHL12(2)    --------->At4g35610  <---------HSFB2a(2)--------->WOX13(2)
--------->DOF2     ----------->GT1 ---------->DOF2   --------->AHL12(2) <---------AHL12(1) <--------
 
ccgaaagaacccaaaatacaaatggttttttttttaaaaaaagtttttttgctgaaaatatattctttttttagaaaatttatgttcataattagttatt  11681500
                  --------->KAN1
             ----------->GT1
           <---------ANAC58
    ---------->DOF2                                       --------->GLK1(2)
   ------>ZmHOX2a(1)                            --------->YAB5
 ----------------->AGL2                         --------->YAB1
 ----------------->AG                          <---------YAB5
===================MADS_MADS                   <---------KAN1       <---------KAN1         <--------
->ATHB12   <---------ANAC46                 <------ZmHOX2a(1)<----------DOF2               =========
-YAB5--------->DAG2  --------->YAB5    <----------DOF2   <---------RVE1(2)                <---------DOF5.7(1)
-RVE1(2)   <---------ANAC58       --------->ALFIN1       <---------GLK1(2)              <-----------GT1
 
ggaatcctaaagtggcatgaaaaatgcttagaaacaagtgggcattaggaatcagtatgagattctttagaatttgtgtttgaaaacaatttctcttttc  11681600
                               --------->At4g35610
                               <---------At4g35610
                               <---------ZAT2
                               --------->ZAT2                                                      -
                          --------->ANAC58                                                         <
                          --------->ANAC55(2)                                                     --
                          --------->ANAC58                                                        <-
                          <---------ANAC55(2)                                      <---------MYB52(1)
                          --------->ANAC55(1)                                 <---------ALFIN1    --
                          --------->O2                                     --------->ANAC46       <-
                          ======================bZIP_DOF                   --------->ANAC58       --
                          <---------O2                                     --------->ANAC58       <-
                          --------->TGA1a                                --------->MYB52(1)       <-
                          <---------TGA1a--------->TOE1(2)               ------>MYB46(1)          --
                          --------->ANAC46--------->CCA1(2)              ------>MYB83             <-
                     ----------->HVH21 --------->ANAC58                ------->GAMYB             ---
                     --------->ANAC46  --------->ANAC58                --------->AtMYB61        <---
                 ------>ZmHOX2a(1) ----------->HVH21                  --------->MYB46(3)        ----
  ------>ZmHOX2a(1)--------->REM1(1) ---------->DOF2                 -------->P------>NtERF2    ----
--DOF2  --------->YAB1    --------->bZIP60(2)                       --------->WOX13(1)          <---
====================================bZIP_DOF   --------->ZAT2      --------->MYB46(3)     ----------
 
gactccttcaatgttaagtcctacatgacacgtaagctgtgaaagctacgagcagagacgattttagccatcaaccaaacgacaccgtttctaaacaata  11681700
<---------YAB1
-------->AHL12(2)
---------AHL12(2)
------->AHL12(1)
--------AHL25(3)
------->AHL20(2)
--------AHL25(1)                                                            <---------ALFIN1
------->AHL25(1)                                                           <------NtERF2
--------AHL12(3)                                                           <---------SPL7(1)
--------AHL20(2)                                                           --------->ABI4(1)
------->AHL12(3)                                        --------->DOF5.7(1)<---------ABI4(2)
--------AHL12(1)                                   --------->HSFC1(1)      ------>NtERF2
------>AHL25(3)                 <---------WOX13(2) <---------HSFC1(1)     --------->RAP2.6(2)
------AHL12(3)                <---------YAB1       <---------HSFB2a(2)    --------->DEAR3(1)       -
----->AHL12(2)               ------------>CBF <<<<<<<<<CBP60g            --------->RAP2.3(1)       <
----->AHL12(3)              <-----------GT1   <<<<<<<<<SARD1       --------->MYB46(3)              <
------AHL12(2)   ----------->GT1--------->WOX13(2) --------->HSFB2a(2) --------->DEAR3(1)   <-------
-->CBF           <---------ZAT6*TSS   --------->KAN1  ---------->DOF2<-----------HVH21  --------->KAN1
 
tttatttttgtatgtttttagtgtaacaaaattacaattgaaaattccaaatttcgagaaagagagaagacccatcgccgcaccgcttgagtcactcttc  11681800
                                                                                        --------->TOE1(3)
                                                                               <---------ARR14(2)
                                                                            --------------->AGL15
                                                                            <---------------AGL15
                                                                           ----------------->AGL2
                                  <---------ICU4                           <-----------------AGL3
                                  --------->YAB5                           <-----------------AG
        ---------->DOF2        <-----------GT1                             ----------------->AGL1
 --------->LBD16           --------->KAN1                                  <-----------------AGL1
--------->LBD16          --------->YAB1                        <---------TOE1(2)        --------->TOE2(3)
-------->HSFB2a(2)    ------->GAMYB                     ------>ZmHOX2a(1)  ----------------->AGL3
---------LBD16       --------->MYB46(3)               <---------DOF5.7(1)--------->ANAC58
---------HSFB2a(2)   <---------MYB52(2)              ------>ZmHOX2a(1)   --------->ANAC58    <------
--DOF5.7(1)        ----------->RAV1(1)       <<<<<<<<<TBF1    ------>ZmHOX2a(1)--------->ARR14(2)---
 
ttcccggagaagaaagaaacaacaacaaacatattcaccattaccttcttcttctcctccttctccttcgtttctcactccaaatttggaaccctaaatc  11681900
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
     ------>ZmHOX2a(1)                                          --------->LBD16                   --
    --------->TOE1(2)                                           --------->At5g28300    <---------ARR14(2)
 --------->RVE1(2)                    <---------TOE2(3)        <---------ANAC46        <---------ARR11(2)
 --------->ARR11(3)                   <---------TOE1(3)        <---------ANAC58        --------->ARR11(2)
 <---------ARR11(3)               --------->TOE2(3)            <---------ANAC58  --------->LBD16 <--
<---------KAN1                  --------->ICU4               <---------At5g28300<-----------RAV1(2)<
--------->KAN1                 --------->GLK1(1)        --------->KAN1       --------->GLK1(2)  ----
---GATA12                      <---------GLK1(1)       <---------RVE1(2)   --------->KAN1    <------
--->ZmHOX2a(1)             --------->YAB1       <------ZmHOX2a(1)----------->HVH21  --------->ALFIN1
 
ctaatatccttcgattagttctcttctctatcggaattcttaacgttgagaggagtctgatatttgccgtgactcaagagattccaggtgtttccgacgt  11682000
               <---------MYB46(3)
            <---------ANAC58
            --------->bZIP60(1)
            <---------ANAC58                              <---------CCA1(2)
      <---------RVE1(2)                                  --------->RVE1(2)
   <-----------GT1                                       <---------ARR14(2)
   <---------AHL20(2)                                    <---------ARR11(2)
<---------AHL12(2)                                       --------->ARR11(2)
-------->AHL12(1)                                        --------->ARR14(2)
---------AHL20(2)                                        ------->TEIL
---------AHL12(3)                                        <-----------ARR10
-------->AHL12(3)                                        <---------ARR11(1)
--------ARR11(3)                                --------->GLK1(2)
--------AHL20(1)                               <---------GLK1(2)                           ---------
------->AHL25(3)        ----------->HVH21    <---------TOE1(3)                             ---------
------->ARR11(3)<-------GAMYB                <---------TOE2(3)                             <--------
-------CCA1(2)<------NtERF2                  <---------YAB1         ---------->ID1         <--------
---------AHL12(1)<---------MYB52(1)       <---------MYB52(1)     ------>ZmHOX2a(1)<---------DOF5.7(1)
--->TEIL    <---------bZIP60(1)          <-------GAMYB  <---------ARR14(1)   ---------->ID1<--------
---ANAC46   <---------ANAC46      ------>ZmHOX2a(1)     <---------CCA1(2)    <---------CCA1(2) -----
 
atatatttacatatggcgtcgttggctctgacttctcctccctccgttaagattccttcgtatctctcctcgtcgtcttcgtctctcttctcccgttcct  11682100
                                             --------->ARR11(2)
                                             <---------ARR14(2)
                                             --------->ARR14(2)
                                       <---------ARR11(2)
                                       --------->ARR14(2)
                                       --------->GLK1(2)
                                       <---------ARR14(2)
                                       --------->ARR11(2)
                                     <----------DOF2
                                    <---------ANAC58
                                    <---------ANAC58
                               <---------ARR14(2)
                               <---------ARR11(2)
                               --------->GATA12                                      --------->WOX13(2)
                               <---------GATA12                                      <---------TOE2(3)
                               <-----------ARR10                                     <---------WOX13(2)
                               <---------ARR11(1)                          --------->TOE2(3)
    xxxxxxxxxxxxxxxx>smallRNA(i)<---------KAN1                       <---------AHL12(2)
   <----------DOF2             --------->ARR14(2)   --------->At5g28300 <-----------GT1
>ARR11(2)                      --------->GLK1(2)  <---------DEAR3(1)--------->AHL25(2)
>ARR14(2)                      --------->ARR11(2)<---------LBD16    --------->AHL25(1)
-ARR14(2)                      ------->TEIL  <---------ARR11(2)     <---------AHL25(2)             -
-MYB52(1)                     <---------CCA1(2) --------->ANAC55(2) --------->AHL12(3)            <-
-ARR11(2)<------ZmHOX2a(1) <---------HSFB2a(2)  <---------ANAC46    <---------AHL20(2)<---------YAB5
->ZmHOX2a(1)               --------->HSFB2a(2)--------->KAN1       <---------DOF5.7(1)<---------YAB1
 
cgatttctttcaggaccactgagtctcgctctcgaatctgcgtttctggttacgcggtgagcattgagcattttttttccttcatgttaatgaatgaatt  11682200
<- Previous    Next ->

AGI:  At1g32380.1   
Description:  ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2). Identical to Ribose-phosphate pyrophosphokinase 2 (PRS2) [Arabidopsis Thaliana] (GB:Q42583;GB:Q9LQM0); similar to ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) [Arabidopsis thaliana] (TAIR:AT2G35390.2); similar to ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) [Arabidopsis thaliana] (TAIR:AT2G35390.1); similar to Ribose-phosphate pyrophosphokinase 2, chloroplast precursor (Phosphoribosyl pyrophosphate synthetase 2) (GB:Q9XG99); contains InterPro domain Phosphoribosyl pyrophospha
Range:  from: 11681732    to: 11684458    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version