AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                              <---------TOE2(3)
                                                      <---------WOX13(2)
                                                      <---------AHL12(2)
                                                   --------->AHL25(1)
                                                   <---------AHL25(1)
                                                   --------->AHL20(3)
                                                   <---------AHL20(2)
                                                   --------->AHL20(2)
                                                   <---------AHL25(2)
                                                --------->WOX13(2)
                                                <---------WOX13(2)
                                           <---------At4g35610<---------TOE2(2)
                                           --------->At4g35610<---------TOE1(2)
                           <---------TOE2(3)   --------------->AGL15                               =
                        <----------DOF2 <---------YAB5--------->AHL12(2)               <-----------GT1
  --------->YAB5     <-----------GT1  --------->YAB1<---------YAB1     <-----------HVH21           <
  --------->YAB1     <---------AHL20(2)<-----------HVH21--------->AHL20(2)  --------->ARR14(2)    <-
 <---------YAB5 <---------RVE1(2)   --------->WOX13(2)--------->WOX13(2)    <---------ARR14(2)    <-
 
tggaatcataaactagtttgatattaactttaggttttcaattgtcatctccattaaaattaacttaggttttctgtcatatactgtattttgctgtttt  10876400
             --------->KAN1
        ----------->HVH21
      ===================================================bZIP_DOF
      <---------ANAC58
      <---------ANAC58
      <---------ANAC46
      <---------bZIP60(1)
      <---------bZIP60(2)                                                     <----------DOF2
      --------->bZIP60(1)                                                    <---------DOF5.7(1)
      <---------TGA1a                                                 <---------ZAT18
      --------->O2                                                    --------->At4g35610
      <---------O2                                                    --------->ZAT14
      --------->TGA1a                                              ------>ZmHOX2a(1)
================bZIP_DOF    ------>ZmHOX2a(1)               <--------P<---------At4g35610
----------DOF2              --------->LBD16--------->At5g28300 <---------ARR14(2)
--------ANAC58            ----------->RAV1(2) ---------->DOF2<---------MYB46(3)    <---------ANAC46
--------ANAC58--------->TOE1(2)      --------->YAB5 <<<<<<<<<<<<<<<<<LFY    <---------DOF5.7(1)
 
tgctttgtgtcgtgactcgtgcgatagactcctgagacaatgactcggtaaaagttgacattggtagttcctgtgctccctctttgacttggatgccaag  10876500
                                                                                      <----------DOF2
                                                                                      <---------DAG2
                                                                                 <-----------HVH21
                                                                               ------->MYC2
                                                                               <-------MYC3
                                                                               ------->MYC3
                                                                               <-------MYC2
                                                                               <-------PIF5
                                                                              --------->ANAC55(2)
                                                                              --------->ANAC46
                                                                              --------->O2
                                                                              ======================
                                  ------>ZmHOX2a(1)                           ===================bZIP_DOF
                                 --------->TOE2(3)                            <---------TGA1a
                                <-----------------AGL1                        ======================
                                ----------------->AGL1                        <---------O2
                                ----------------->AG                          --------->TGA1a
                           <---------AHL25(1)                                 ======================
                           --------->AHL20(2)                           <----------DOF2
                           <---------AHL20(2)                           ================bZIP_DOF
                         <----------DOF2                          <---------ALFIN1    <---------DOF5.7(1)
                         --------->TOE2(3)                     --------->ANAC46------->MYC4
                        --------->YAB5                    --------->DOF5.7(1) ======================
                      --------->ARR11(3)                ---------->DOF2<---------DOF5.7(1)
                      <---------ARR11(1)     --------->ANAC58  --------->ANAC58------->PIF5
                      --------->GATA12       --------->ANAC58  --------->ANAC58<-------MYC4  <------
     ------->GAMYB   <---------CCA1(2)  <----------ID1  ================================bZIP_DOF<---
 
ttttctaaccgaaattactaagtcaaatctttaattcctaaatgggccaagcccaaactaaaagacgcgctacctctttccacgtgtcactttttgttac  10876600
                                         <---------AHL25(1)
                                         <---------AHL25(3)
                                         <---------AHL20(2)
                                        <---------YAB1
                                       --------->AHL12(2)
          <----------DOF2              <---------AHL12(2)
    ---------->DOF2                    --------->WOX13(2)                                     ------
 --------->ETT(1)                      <---------WOX13(2)                                     ------
---------->ID1                        --------->YAB5<-----------TBP                           <-----
===============bZIP_DOF              <---------YAB1<---------DOF5.7(1)                        ------
==========================bZIP_DOF  --------->ARR11(3)--------->AHL20(2)                      <-----
=====================bZIP_DOF       <---------ARR11(3)<-----------TBP                     --------->YAB1
=======bZIP_DOF             --------->TOE2(3)     <---------DOF5.7(1)                   --------->RVE1(2)
-----GT1 <---------DOF5.7(1)--------->TOE1(3)     <----------DOF2               ---------->DOF2-----
-------DOF2    <----------DOF2  ---------->DOF2  <---------DOF5.7(1)        ---------->DOF2  <------
 
tttgtcgcaaagtcttttctttttctcttaaccttaaaagataattaatgggcctttttatatagaggcccatttatctgaaagaaagcgaaatcaaaat  10876700
                                                                                                <---
                                                                                                ----
      ---------->ID1                                                                            <---
  --------------------->WRI1                                                                    ----
  <----------DOF2                                                                           <-------
--->RVE1(2)                                                                               <---------
--->GLK1(2)                                                          ------>ZmHOX2a(1)    <---------ANAC58
------ARR10                                                     <---------GLK1(1)         ----------
--->ARR11(3)                                         ---------->DOF2--------->TOE2(3)     <---------ANAC58
----ARR11(3)           ------>ZmHOX2a(1)   ----------->HVH21>>>>>>>>>TBF1               <-----------GT1
---->RVE1(1)   <<<<<<<<<TBF1           ---------->DOF2 --------->DOF5.7(1)             <-----------GT1
---GLK1(2)<----------DOF2  ------>ZmHOX2a(1)----------->RAV1(1) --------->GLK1(1)------------>CBF
 
ctctcctttgtttctttcttcttctccttcctccataagacaagaagcgacagagggaaagaagaagaattcctaaaacccttgagcaattttccgtttc  10876800
         <-----------------AGL1
         --------->SPL7(1)
       <---------SPL7(1)
      <---------ANAC58
      <---------ANAC58
    ------>ZmHOX2a(2)
   <------ZmHOX2a(2)
  <---------GATA12
  --------->GATA12
  <---------ARR11(3)
  --------->ARR11(3)
  <---------ARR14(2)
  --------->ARR14(2)
------HSFC1(1)
----->HSFC1(1)                                                                               <------
------HSFB2a(2)        --------->HSFB2a(2)                       <---------ATHB12            <------
----->HSFB2a(2)        <---------HSFB2a(2)                  <<<<<<<<<<<<<<<<<LFY   --------->GLK1(1)
--MYB52(1)        ---------->ID1--------->RVE1(2)           >>>>>>>>>>>>>>>>>LFY   <---------GLK1(1)
------AGL15  <---------ARR14(2)--------->TGA1a         ---------->DOF2 <-----------GT1      --------
----->AGL15  --------->ARR14(2)===================================bZIP_DOF <---------At4g35610
 
tagaagatcgcgtccggttttggcctctagacccatgtctgaaaacgtccctgatcaccaaagtaccaatggtttttcatcttccgatttctgtatattt  10876900
                                <---------RVE1(2)
                                <---------GLK1(2)
                              <---------YAB1
                          --------->ARR14(2)
                          <---------GLK1(2)
                          <---------ARR14(2)
                        <---------YAB1
                      --------->YAB1
                    <---------WOX13(2)
        --------->GLK1(1)<------ZmHOX2a(1)
---AHL20(3)         --------->WOX13(2)    ------>ZmHOX2a(1)
---AHL20(2)        --------->WOX13(1)    <---------YAB1                                          ---
->AHL12(2)  <----------DOF2--------->GLK1(2)                    <-----------GT1       <---------YAB1
 
ttgaaattggggtttctttagtcaattaggattctgattctgttcctattgctcccattcttcagtttcactatgttttcatgcttcttgttattgagtc  10877000
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                        --------->LBD16                                     <-------
                                        ------>ZmHOX2a(1)                                   <-------
                                  <---------MYB46(3)                                        --------
   <---------ARR11(2)             --------->KAN1     --------->ANAC58       --------->WOX13(2)   <--
   <-----------GT1        <----------DOF2    >>>>>>>>>TBF1      <---------MYB46(3)   <----------DOF2
--->ZmHOX2a(1)   ------->TEIL    <---------YAB5      --------->ANAC58       <---------WOX13(2)   ---
 
ctcgtgtttccatttgtatgcattttctgctttgtagttgttcctgaagaagaagcaggcaagaaggttgttctgtctaaattagtgactttgatgcgta  10877100
                                                    <---------WOX13(1)
<-----------HVH21                                  <---------ANAC58
--ANAC58                                   --------->ANAC55(2)
--->GT1  --------->ANAC58                  <---------ANAC55(2)
--ANAC58 --------->ANAC58             <------ZmHOX2a(1)
--ANAC55(2)                         --------->LBD16<---------ANAC46                               --
--ANAC46 --------->ANAC46          <-----------RAV1(2)                                         <----
->ANAC55(2)                        --------->HSFB2a(2)    --------->KAN1             --------->KAN1
-------WOX13(2)                    <---------HSFB2a(2) <---------RVE1(2)           <---------AHL12(3)
------>WOX13(2)                  ------>ZmHOX2a(1) <---------ANAC58                <---------AHL20(2)
 
aattgtcagaacaaggaatcgatgctcaaaactgtcctccaggagtacgtagttgcttgatatgtccgaaggtatcgcatgcttatatatatgccaatac  10877200
                                              ----------->GT1
                                             --------->DAG2
                                             --------->DOF5.7(1)
                                            --------->DOF5.7(1)
                                   <---------ARR14(2)                   <----------DOF2
                                   <---------ARR11(2)               <---------PCF2
                                   <---------ARR11(3)              <---------ANAC58
                        <-------TEIL       ---------->DOF2         <---------ANAC58
                   <---------WOX13(1)<---------ANAC46             <---------MYB46(3)
                  <---------ANAC46 --------->ARR14(2)            <---------ANAC46
                  <---------ANAC58 --------->GLK1(2)         <---------ANAC58
            <---------RVE1(2)   <---------ANAC58   --------->WOX13(2) --------->ZAT18        <------
-------->DOF2<-----------RAV1(1)<---------ANAC58   <---------WOX13(2) <-------TEIL      <---------RVE1(2)
-----ANAC55(2)    <---------ANAC58 --------->ARR11(3)        <---------ANAC58<---------ZAT6---------
 
ttaaagtactatgtggatgttgcttgattcatgttgagtatcttggaaaaggctaatttagataacttgtgggtgcattagtgtgaagttggagactctg  10877300
<- Previous    Next ->

AGI:  At1g30660.1   
Description:  toprim domain-containing protein. similar to toprim domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G30680.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42605.1); contains InterPro domain Toprim, primase; (InterPro:IPR006647); contains InterPro domain Toprim subdomain; (InterPro:IPR006154); contains InterPro domain TOPRIM; (InterPro:IPR006171)
Range:  from: 10876835    to: 10878999    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version