AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                               <---------TOE2(3)
                                                                             <---------AHL20(2)
                                                                           <---------WOX13(2)
                                                                           --------->WOX13(2)
                                                                           <---------AHL12(2)
                                                                          <---------AHL25(3)
                                                                         <---------AHL25(1)
                                                                         --------->AHL25(1)
                                                                         --------->AHL20(3)
                                                                         --------->AHL25(2)
                                                                         <---------AHL25(2)
                                                                         --------->AHL25(3)
                                                                         <---------AHL25(3)
                                                                         --------->AHL20(2)
                                                                         <---------AHL20(2)
                                                                         --------->AHL20(1)
                                                                         --------->AHL12(1)
                                                                         <---------AHL12(1)
                                                                         <---------AHL12(3)       --
       <---------ANAC58                      <---------ANAC58           --------->AHL25(3)     -----
       <---------ANAC58                      <---------ANAC58           <---------KAN1       <------
     <---------YAB1                        ------>NtERF2             --------->LBD16         -------
---------RVE1(2)                       ------>ZmHOX2a(2)            --------->LBD16      --------->YAB1
------>ETT(2)                    <---------ANAC58                  <---------HSFB2a(2)   --------->TOE2(3)
--->ALFIN1                       <---------ANAC58                  --------->HSFB2a(2) ------->TEIL
--bZIP60(2) <---------REM1(1)--------->DEAR3(1)----------->HVH21  <---------LBD16     <---------CCA1(2)
 
tcgatattatgcttgttgtaccaatgctcgagccgagcgtgatcgatgccttgacaaactatatatgtttcccgaattaattaagttttgtatcttaatt  10618600
                                                       --------->WOX13(2)
                                                       <---------WOX13(2)
                                                      <---------ICU4
                                                     --------->AHL20(2)
                                                     <---------AHL20(2)
                                                     --------->AHL25(1)
                                                     <---------AHL25(1)
                                                     --------->AHL12(1)
                                                     --------->AHL25(3)            -------->P
                                                    --------->AHL12(3)             ------>MYB46(1)
                                                    --------->AHL20(3)             ------>MYB83
                                                    <---------AHL20(2)             --------->MYB52(1)
                                                    <---------AHL12(3)            --------->MYB55(1)
                                                    --------->AHL25(3)           <---------MYB111(2)
                                                   --------->YAB1                --------->DEAR3(1)
                                            <---------ARR11(2)                   <---------MYB46(2)
                                         <---------ANAC55(2)                     <---------MYB111(1)
                                         --------->ANAC55(2)                     --------->MYB46(3)
                                       --------->CCA1(2)                         <---------MYB59
        <---------YAB1                --------->ARR11(3)                        --------->At4g35610
       --------->AHL20(2)             <---------ARR11(3)                    <---------ATERF1(1)
       --------->AHL20(3)             <---------ARR14(2)                   ------>NtERF2          <-
       <---------AHL20(3)             --------->ARR14(2)   <-----------------AGL3<---------MYB55(2)
 <-----------GT1                    ----------->ARR10<---------AHL12(1)    --------->LBD16        --
<---------KAN1                      --------->ANAC58<---------AHL20(3)    <---------ANAC46 ---------
------->YAB1                 <---------At4g35610------>ZmHOX2a(1)    <------------CBF     <---------KAN1
---->YAB1                   --------->ANAC58------->TEIL <-----------GT1  <---------LBD16<---------ARR11(3)
---WOX13(2)     ----------->GT1     --------->ANAC58<---------AHL25(2)   <---------LBD16<------ZmHOX2a(1)
-->WOX13(2)<-----------GT1  --------->ANAC58--------->ARR11(2)----------->TBP   <---------At4g35610
 
agaataacatttttatacaatgtaatttctcaagcagacaagatatgtatcctatattaattactatatatgaattgccgggcacctaccaggatgtttc  10618700
                                                                                     <---------AHL25(1)
                                                                                     <---------AHL12(3)
                                                                                     --------->AHL12(3)
                                                                                    <---------AHL20(1)
                                                                                    --------->AHL25(3)
                                             --------->ARR11(3)                    --------->AHL12(2)
                                    <---------bZIP60(1)                            --------->AHL12(3)
                                    <---------ANAC55(2)                            <---------AHL12(2)
                                    --------->bZIP60(1)                            <---------AHL12(3)
                                    <---------bZIP60(2)                           --------->AHL20(1)
                                    --------->ANAC55(2)                           <---------AHL20(1)
                                 ----------->TGA1     <---------ANAC58          --------->AHL12(2)
                               <---------ICU4<---------ARR11(3)                 <---------AHL12(2)
                            --------->YAB1   --------->RVE1(2)                 --------->AHL20(2)
                        ---------->DOF2      --------->GATA12                  --------->AHL25(1)
                     --------->ANAC46  ----------->RAV1(1)                     <---------AHL20(3)
                     --------->ANAC58 <----------ID1  <---------ANAC58         --------->YAB1
                     --------->ANAC58 ----------->HVH21  <-----------HVH21     --------->AHL20(3)
--------ARR14(2)     --------->ANAC55(1)     --------->GLK1(2)            ------------>CBF     -----
------->ARR14(2)--------->ARR11(2)--------->YAB5   <---------GLK1(2)  --------->YAB5--------->AHL20(1)
>YAB5      <---------MYB52(1)------------>CBF<---------GATA12        ------------>CBF<---------AHL20(2)
 
aaatacgagagcccattagtttccacgtaaatcacaatgacgcgacaaaatctagaatcgtgtcaaaactctatcaatacaataatatatatttcaaggg  10618800
                              ------->GAMYB
                             --------->ANAC58
                      --------->ATHB12
                      --------->YAB5                                          --------->YAB1
                      <--------ATHB1                                   --------->YAB1
                      <------------ATHB5                              <------ZmHOX2a(2)
                     <---------ATHB12       ----------->TBP          --------->ARR11(3)        -----
                     <---------YAB5    --------->YAB5  --------->REM1(1) <---------YAB5<---------ALFIN1
                     --------->ICU4    --------->RVE1(2)  --------->ANAC46 --------->WOX13(1)<------
                 ------------>CBF    ------->TEIL--------->DOF5.7(1) <---------ARR11(3)------->GAMYB
            ------>ZmHOX2a(1)--------->ANAC46  ---------->DOF2      <------ZmHOX2a(1)  ----------->RAV1(1)
------->CBF--------->ANAC46  --------->ANAC58 <---------AHL20(2)---------->DOF2       --------->MYB46(3)
 
caatttcgacttctcctcaactcaatgattcaacgccatgaatctctatataaaggctacaacaccacaaaggatcatcagtcatcacaaccacattaac  10618900
                                      <---------ANAC55(2)    --------->TOE2(1)
                                      <---------ANAC46       --------->TOE1(1)
                                      ----------->GT1--------->GLK1(1)
                                    <---------ANAC46 ---------->DOF2            ---------->DOF2
       --------->RVE1(2)         ----------->HVH21   --------->KAN1     <---------HSFB2a(2)
---->ZAT6                      <---------ANAC58     --------->ARR11(2)  --------->HSFB2a(2)      ---
-----GT1    ------------>CBF   <---------ANAC58     --------->ARR14(2) ------>ZmHOX2a(2)    --------
 
tcttcaccactatctctcaatctctcgtttcatttcttgacgcgtgaaaatgacagaaatgccctcgtacatgatcgagaacccaaagttcgagccaaag  10619000
                                           ------>ZmHOX2a(2)
                                          <------ZmHOX2a(2)
                                         --------->ARR14(2)
                                         <---------ARR11(2)
                                         --------->ARR11(2)                          --------->ARR11(3)
                                         <---------ARR14(2)   <----------DOF2        <---------ARR11(3)
                                         --------->ARR11(3)  ------>ZmHOX2a(2)   --------->YAB5
                                         <---------ARR11(3)<---------ARR11(3)    <-----------GT1
        <-----------GT1        <---------DOF5.7(1)         --------->ARR11(3)    --------->ZAT6
  ----------->GT1      <---------ANAC58  --------->GATA12<---------YAB1        --------->RVE1(2)
------>MYB52(1)        <---------ANAC58  <---------GATA12<---------YAB5 <---------HSFB2a(2)       --
-->DOF2<---------YAB1 --------->YAB5<-----------GT1<-------TEIL    --------->ANAC55(2)         <----
 
aaacgacgttattactcttcttcgatgcttaccatcttcttaccgatcttcacatacattatgatctttcacgttttcgaagtatcactatcttcggtct  10619100
                                                       --------->YAB5
                                                     <-----------------AGL3
                                                     <------NtERF2
                                                    --------->LBD16
                                                    ------>NtERF2
                                                   --------->RAP2.6(2)
                                                   --------->DEAR3(1)
                                                   --------->RAP2.3(2)
                                                  --------->ERF1
                                                  --------->MYB46(3)
                                              ---------->DOF2
                                        --------->TOE2(3)      <---------ARR11(2)
                        --------->RVE1(2)------>ZmHOX2a(1)     --------->ARR11(2)
          <---------ARR11(3)        --------->KAN1--------->RAP2.3(1)                             --
      ---------->DOF2  <---------At4g35610   <---------ICU4 <---------YAB1  ---------->DOF2    <----
-------->DOF2          --------->At4g35610--------->YAB1 <---------ATHB51--------->YAB1    <--------
------DOF2--------->ARR11(3)  --------->KAN1<---------YAB1  <---------TOE2(3) --------->DOF5.7(1)---
 
ttaaagacacaaaggtcttgttcttcatctccaatactctcatcctcataatagccgccgattatggttccttctctgataaagagagtcaagactttta  10619200
                  <------NtERF2           --------->YAB5
               --------->At4g35610        <---------ICU4
         <-----------HVH21          <---------At4g35610
    <---------ZAT14                 --------->ZAT2
  <---------ARR11(2)          --------->ARR11(2)
  --------->ARR11(2)          --------->ARR14(2)                                                 <--
------->At5g28300--------->RAP2.6(2)<---------ZAT2    --------->ARR11(2)              --------->DOF5.7(1)
-----At5g28300 <------NtERF2  <---------ARR14(2)      <---------GLK1(2)             ---------->DOF2
--DOF2  <-----------RAV1(1)   <---------ARR11(2)      --------->ARR14(2)        --------->ZAT6 -----
-------->GT1   <---------At4g35610  --------->At4g35610               --------->MYB52(1)  ----------
 
cggtgaatacactgtcgcagcggcaacgatgcgaaaccgagctgataactactctccgattcccgtcttgacataccgagaaaacactaaagatggagaa  10619300
                                                                           <-----------GT1
                                                                         --------->ARR11(2)
                                                                         <-----------ARR10
                                                                         --------->ARR14(2)
                                                             --------->GLK1(1)
                                               --------->MYB46(3)        <---------ARR14(2)
                                               --------->DEAR3(2)        <---------ARR11(2)
                                              ------->TEIL   <---------GLK1(1)
          --------->DOF5.7(1)                <---------ARR14(2)       <---------ANAC58
        ---------->DOF2                      --------->ARR11(2)       <---------ANAC58
     --------->TOE2(3)                       --------->MYB52(1)       <---------ANAC46
-------ATHB12            <------ZmHOX2a(1)   <---------ARR11(2)<---------YAB1      --------->LBD16
---->GLK1(1)--------->ARR11(3)      >>>>>>>>>TBF1           <---------ARR11(3)    --------->LBD16
->GT1--------->TOE1(3)<---------LBD16   <----------ID1      --------->ARR11(3) ------>ZmHOX2a(1)   -
 
atcaagaaccctaaagatgtcgaattcaggaaccctgaagaagaagacgaaccgatggtgaaagatatcatttgcgtttctcctcccgagaaaatagtac  10619400
                                                                       <---------ANAC58       ------
                                                                       <---------ANAC58       ------
                                                                      --------->STY1(2)       ------
                                                        --------->ANAC55(2)        <---------ANAC58
                                <---------RVE1(2)       <---------HSFB2a(2)        <---------ANAC58
  <---------ANAC46            ------->TEIL              <---------ANAC55(2)       <---------HSFC1(2)
<---------MYB46(3)         <---------REM1(1)            --------->HSFB2a(2)       --------->HSFC1(2)
-------->ALFIN1       <---------At4g35610      --------->ANAC46       <---------STY1(2) ----------->RAV1(1)
 
gagtggtgagtgagaagaaacagagagatgatgtagctatggaagaatacaaaccagttacagaacaaactcttgctagcgaagaagcttgcaacacaag  10619500
<- Previous    Next ->

AGI:  At1g30190.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G34610.1)
Range:  from: 10618950    to: 10619786    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version