AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                 <---------DOF5.7(1)
                           ------>MYB46(1)                                    <---------ANAC58
      <---------ZAT2    <---------MYB55(2)                               <---------ICU4
      --------->ZAT2    --------->MYB46(3)                              <---------YAB1
      --------->At4g35610  ------>MYB83                                 <---------YAB5         <----
      <---------At4g35610--------->AtMYB61                          ------>ZmHOX2a(2)       <-------
      ----------->RAV1(2)------->GAMYB                              ==========================HOX2a_HOX2a
<---------YAB5         --------->ANAC58                           --------->GATA12     ------>ZmHOX2a(1)
------->YAB1           -------->P                                 <---------GATA12 <-----------GT1
-------YAB5            --------->ANAC58                           <---------ARR11(3)   =============
----->ANAC58          --------->WOX13(1)                      <---------ANAC58<---------ANAC46 <----
----->ANAC58  <----------DOF2------->GAMYB  <---------KAN1    <---------ANAC58<---------ANAC58------
 
agcatcatcagctgtctctttgaatcaaccaactcacttggactagaattagggctagagttgtttcttgatctcatcatggcgtttttcctgttgatcc  9899500
                                                                                                <---
                      --------->ANAC58                                                         <----
                   <------ZmHOX2a(2)                                                         <------
                  <---------GATA12                                                           -------
                  --------->GATA12                            --------->MYB46(3)          --------->ANAC55(2)
                  --------->ARR14(2)                         -------->P                   <---------ANAC58
                  <---------ARR14(2)                         --------->MYB52(1)           <---------ANAC58
                  <---------ARR11(2)                         ------>MYB46(1)              <---------ANAC55(2)
                  --------->ARR11(2)                         ------>MYB83 <---------ARR14(2) -------
        <---------YAB5--------->ANAC58                      --------->MYB55(1)            <---------ANAC46
       <-----------HVH21                                   <---------MYB46(2)        <---------MYB52(1)
  --------->KAN1  --------->RVE1(2)                        <---------MYB111(2)      --------->LBD16
-----ANAC58     --------->LBD16                            --------->MYB46(3)<-----------GT1 <------
--RVE1(2) <---------SPL7(1)  <---------ALFIN1              <---------MYB111(1)    <---------LBD16---
=HOX2a_HOX2a   --------->ANAC46              <---------MYB52(2)           --------->ARR11(2) -------
-----ANAC58   <---------LBD16--------->AtMYB61       --------->YAB5       --------->ARR14(2)--------
>ZmHOX2a(2)--------->KAN1   --------->MYB46(3)       <---------ICU4    <---------MYB59    --------->ANAC46
 
ttgccatcttcgtcatacgcggatcaagaaaaccacctctctcttgccacaaacaaggattaccaaccagagaaccgaattcacttccggtttgcgtaac  9899600
                                                   ------>NtERF2
                                                   <---------ATERF1(1)
                                                  --------->RRTF1(3)
                                                  --------->RAP2.3(3)
                                                  --------->DREB2C(2)
                                                  --------->DEAR3(1)
                                                  <---------ATERF1(2)
                                                  --------->ATERF1(2)
                                                  --------->RAP2.3(2)
                                                  --------->RAP2.6(2)
       <------ZmHOX2a(1)                         --------->ATERF1(1)
     <---------TOE2(3)                           --------->RAP2.6(1)
  ------>ZmHOX2a(2)                              --------->ERF1
 <---------At4g35610                             --------->RAP2.3(1)
 =============HOX2a_HOX2a                        --------->RRTF1(1)
 --------->At4g35610                             --------->DEAR4(2)
 <------ZmHOX2a(2)                               --------->ORA47(2)
--------->ARR14(2)                              <---------ATERF1(1)
<---------ARR14(2)                              ------>NtERF2
<---------ARR11(3)                              --------->ABI4(1)
<---------GATA12                               --------->DEAR3(1)
--------->GATA12                        <-------TEIL
<---------ARR11(2)                      <---------YAB5 <---------At4g35610
--------->ARR11(2)                    --------->ARR11(2)
<---------AGP1                        <---------ARR11(2)
------LBD16                           <---------ARR14(2)      <---------ALFIN1
-----LBD16                            --------->ARR14(2)  --------->At4g35610
---ARR14(2)                        <---------TOE2(3)<------NtERF2
-->ARR11(2)                     <----------CDC5--------->ANAC46
-->MYB52(1)                    ----------->RAV1(2)--------->RRTF1(2) <---------KAN1
---ARR11(2)           <---------ANAC55(2)--------->YAB1--------->At4g35610        <------NtERF2
------>LBD16       <---------MYB52(1)<------ZmHOX2a(1) ----------->RAV1(2) --------->MYB52(1)<------
-->ARR14(2) --------->ZAT6     --------->At4g35610--------->ANAC46--------->LBD16--------->ANAC58
--->HVH21<---------KAN1        --------->ZAT2 --------->MYB46(3)<---------LBD16  --------->ANAC58 <-
 
cgggatctgaggataacactccgataagtaaaccggctgaggattcatcaccgccgccatctgctccaccgggtatgaaaacggaggcaagaagtgatga  9899700
               --------->YAB1                               <-------TEIL
              <---------YAB1                                ------>ZmHOX2a(2)
             --------->ARR11(3)                            <------ZmHOX2a(2)
            --------->YAB1                                <---------ARR14(2)
           <---------YAB1               <---------ANAC58  <---------ARR11(2)
           --------->ICU4               <---------ANAC58  --------->GATA12
         --------->YAB5               --------->ALFIN1    <---------GATA12
         --------->YAB1           <---------ZAT14         --------->RVE1(2)                    -----
        <---------YAB1            --------->ZAT14         --------->ARR14(2)           <---------ANAC58
        --------->ICU4       <-------GAMYB                --------->ARR11(2)           <---------ANAC46
---bZIP60(2)--------->YAB5   <---------ZAT14             <------ZmHOX2a(1)             <---------ANAC58
---------CDC5<---------ARR11(3)<---------ANAC46 <---------MYB46(3)    --------->ARR11(3)      ------
 
ggctgagcctgatgatgatcataagtagggactgttgtgaagtgcgagcgattgttgttaggatccatagagagttcttggacagagtttgcgttagaag  9899800
                                                                <---------ZAT14
                                                              *TSS
                                                          ------>ZmHOX2a(2)
                                                         <------ZmHOX2a(2)
                                                         --------->CCA1(2)
                                                        --------->ARR11(3)
                                                        <---------ARR11(3)
                                                        <---------ARR14(2)
                                                        --------->ARR14(2)                  <-------
                            --------->LBD16             <---------RVE1(2)                 <---------MYB52(1)
                           --------->LBD16              <---------AGP1                   <-------GAMYB
    ----------->GT1       <---------HSFB2a(2)           --------->AGP1                  <---------MYB46(3)
  --------->DOF5.7(1)     <---------LBD16               --------->GATA12                --------->MYB55(2)
---------->DOF2           --------->HSFB2a(2)           <---------GATA12        --------->DOF5.7(1)<
---->DOF5.7(1)           <---------LBD16               --------->GLK1(1)      ---------->DOF2<------
--->DOF5.7(1)        <---------DOF5.7(1)               <---------GLK1(1)      --------->DOF5.7(1) <-
 
agggaaagggtaagaagttatccatttttcccggagagagagagagagagagggagagagatctgagtgaagaaacaaaaaaaaagagaggtcgttgggg  9899900
       <------ZmHOX2a(1)
  <---------RVE1(2)                                                                 --------->YAB5
 --------->ATHB12                                                           <---------MYB46(3)
 --------->YAB5                                                             ----------->GT1
--MYB46(3)                                                               <---------At4g35610
---------WOX13(1)               --------->ARR11(3)                     <-----------RAV1(2)       <--
---ANAC46                      <---------At4g35610                <-----------RAV1(1)      ---------
-----------CBF     <---------ZAT14              ---------->DOF2   =================RAV     <--------
 
agattgattaggagagagcgagtgaagaagagacagatgttggaaaaacacaaaagaaaacgagtcaaaatgttgcagatggttcaatgtttgcagctta  9900000
                                                                                             <------
                                                                                          <---------
                                                                                         <------NtERF2
                                                                                         --------->ATERF1(1)
                                                                                        ------>NtERF2
                                                                                       <---------bZIP60(1)
       <-----------HVH21                                                               <---------ANAC46
      --------->ANAC46                                                                --------->RAP2.3(1)
     --------->MYB46(3)                                                              <---------ATERF1(1)
  --------->GLK1(1)                                                                 --------->ALFIN1
  <---------GLK1(1)                                                               <-----------RAV1(1)
 <---------ARR11(2)                                                               ==================
 --------->ARR11(2)                  --------->YAB5                            --------->ARR11(2)
 <---------ARR14(2)                 <---------YAB1              --------->ZAT6 <---------ARR11(2)
 --------->ARR14(2)               --------->CCA1(2)            <-------TEIL    <---------ARR14(2)
-------LBD16                     <---------RVE1(2)--------->MYB59              --------->ARR14(2)<--
>At4g35610    <---------ALFIN1   --------->ARR11(3)        <-------TEIL    ------->MYC3--------->bZIP60(1)
-At4g35610   --------->MYB46(3)  <---------ARR11(3) <------ZmHOX2a(1)      <-------MYC3<---------PCF2
 
tggggatacccatcgcaccactcagacaaggagagagatatgaatacagaggttaggacatatacatacactagtacatgtgtatatgtggcgccagatt  9900100
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                   <---------DOF5.7(1)                                                            --
                  <----------DOF2                                                                 <-
                 <---------ANAC58                                                                 <-
---GLK1(2)       <---------ANAC46                                                                 <-
--RAV1(2)        <---------ANAC58                                                                 --
==RAV   ------->TEIL                                  <----------DOF2                       <-------
-------YAB1<---------AHL20(2)                  --------->ATHB12                            <--------
 
gtgtttgaatgtatataatggcttttatggcacagaagaccacgagaaggtcattggctatatgtgttttttctcagagagagagagagaaggctcttta  9900200
            <---------ANAC58
            <---------ANAC58
        <---------GLK1(1)
------->AHL20(3)
--------AHL20(3)
------->AHL25(1)
------->AHL12(3)                                                                              <-----
--------AHL20(1)                             <---------TOE2(3)                               -------
------->AHL20(2)                             --------->DOF5.7(1)                             -------
--------AHL20(2)                   <-----------GT1                                           -------
------->AHL25(2)                <---------AHL12(2)           --------->TOE2(3)               <------
--------AHL25(1)              --------->AHL20(1)     --------->GATA12                        <------
--------AHL25(2)              <---------AHL20(1)     <---------GATA12                        <------
--------AHL25(3)          ------>ZmHOX2a(1)  <---------TOE1(3)                              <-------
------->AHL25(3)         --------------->AGL15       --------->RVE1(2)                  --------->MYB52(1)
---DOF2 --------->GLK1(1)--------->TOE2(3)<---------MYB52(1) --------->TOE1(3)         --------->DOF5.7(1)
-DOF5.7(1)  <---------ANAC46 <---------CCA1(2)       <---------ARR11(1)           ----------->GT1---
 
ttttattttggagttccttggctctcttccttatatattaactctgttaaggtccaaatctataccttaatatgcagttcaaacattgaaaaaacgaatc  9900300
                                       --------->WOX13(2)
                                       <---------WOX13(2)
                                     <---------AHL25(3)
                                     --------->AHL12(3)
                                     --------->AHL20(1)
                                     <---------AHL25(1)
                                     --------->AHL25(3)
                                     --------->AHL25(1)
                                     <---------AHL12(3)
                                     <---------AHL20(1)
                                     <---------AHL20(2)
                                     <---------AHL25(2)
                                     --------->AHL20(2)
                                     --------->AHL25(2)
                                    <---------AHL20(2)
                                    --------->AHL20(2)
                                    <---------AHL25(1)
                                    <---------AHL25(2)
                                    <---------AHL12(1)
                                    --------->AHL12(1)
                                    --------->AHL25(1)
                                    <---------AHL25(3)
                                    --------->AHL25(3)
                                    --------->AHL12(3)
                                  <---------AHL12(2)
                                  <---------WOX13(2)
                                  --------->WOX13(2)
                                 -------->HAHB4
                                 <---------AHL25(3)
                                 --------->YAB1
                                 --------->YAB5
                                 <---------ICU4
                                 --------->ATHB51
                                 <--------ATHB1
                                <---------ATHB51
                                --------->AHL25(3)
    <----------DOF2             <---------AHL12(1)
   <---------DOF5.7(1)          <---------YAB1
 ------->TEIL                   --------->ICU4
---------->ID1                  --------->AHL20(2)
----KAN1                       <---------AHL20(3)
>TEIL                          <---------AHL25(2)
-->GLK1(2)                     --------->AHL20(3)
-->ARR14(2)               <-------TEIL<---------AHL12(2)  --------->YAB1
---ARR14(2)          <---------KAN1 <---------AHL12(3)--------------->AGL15
---ARR11(1)  --------->ARR11(3)--------->AHL25(2)    ----------------->AGL2
-----ARR10   <---------GATA12 --------->YAB1 <---------ZAT6                                        <
--ARR14(1)   <---------ARR11(3)--------->AHL12(2)    ----------------->AGL3                        -
------------>AtSPL8--------->YAB1<--------HAHB4    --------->ANAC46 --------->YAB1           <------
 
tttgtacctttagaaagatttagcataaatgcataataattaaatttagagtaaacaccattaatagccattcatatttttgtataaactaaatttcttt  9900400
<- Previous    Next ->

AGI:  At1g28300.1   
Description:  LEC2 (LEAFY COTYLEDON 2); transcription factor. similar to FUS3 (FUSCA 3), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT3G26790.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO49081.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340)
Range:  from: 9896854    to: 9899863    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version