AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       <---------DOF5.7(2)
      --------->REM1(2)
     ----------->HVH21
     --------->DOF5.7(2)
    --------->LBD16                                       <---------CCA1(2)
    --------->At5g28300                         <---------ANAC58
   <---------ANAC46                             <---------ANAC55(1)
 --------->ABI4(1)                              --------->ANAC55(2)    --------->At4g35610
 ------>NtERF2                                  <---------ANAC55(2)    <---------At4g35610
<---------ALFIN1                     --------->LBD16    --------->ANAC46
------->GAMYB                       <---------ANAC58    --------->ANAC55(2)
--------->DEAR3(1)                  <---------ANAC46    <---------ANAC55(2)       <-------TEIL
--------->DREB2C(2)                 <---------ANAC58   <---------LBD16 --------->ZAT2
-------->DEAR3(2)                  <---------LBD16     <---------HSFB2a(2) <---------ANAC46
-------->MYB46(3)             --------->GATA12  <---------ANAC58       <---------ZAT2
--------ATERF1(1)             <---------ARR11(3)<---------ANAC46       ----------->RAV1(2)
-------ALFIN1                --------->REM1(1) <-------TEIL        <-----------HVH21               -
------ZAT14            <---------GLK1(2)      --------->CCA1(2)   --------->bZIP60(1)          <----
--->ANAC46             --------->ARR14(2)  <---------YAB1--------->LBD16--------->TOE2(2)     ------
 
ccaccgccgtgaacgcgaattgtcccgattctacatcttccgcgtgatgatacgtgttcccgtaactcgatgtcacctgcgtaaattcatgttttcaaat  9225400
                                                                =====================HOX2a_HOX2a
                                                                ------>ZmHOX2a(2)
              ---------->DOF2                                   ===========================HOX2a_HOX2a
          --------->YAB1                                       <------ZmHOX2a(2)
          <---------ICU4                                       ============================HOX2a_HOX2a
         --------->ICU4                                        ======================HOX2a_HOX2a
        <---------AHL25(2)                                    <---------GATA12
        <---------AHL12(2)                                    <---------RVE1(2)
        --------->AHL25(2)        <---------KAN1              --------->ARR14(2)
        <---------AHL20(3)       --------->ARR14(2)           <---------ARR14(2)
        --------->AHL12(2)       <---------RVE1(2)            --------->AGP1
        --------->AHL20(3)       <---------GLK1(2)            --------->GATA12
       --------->YAB1            --------->GATA12             <---------ARR11(3)
       --------->YAB5            <---------ARR14(2)           --------->ARR11(3)
      <---------ATHB51    --------->RVE1(2)                   --------->ARR14(3)
      <---------ATHB12    <---------ARR11(3)                  <---------ARR14(3)                   <
   --------->YAB5         <---------GATA12                   <---------GLK1(1)                    <-
  <---------ATHB12        --------->GLK1(2)                  --------->GLK1(1)              <-------TEIL
--------->WOX13(1)    --------->YAB1              --------->ZAT14                   <------ZmHOX2a(1)
-------->MYB46(3)    <---------YAB1               <---------ZAT14           <---------TOE2(3)     <-
-----ATHB12  --------->YAB1  <---------LBD16  <---------------AtSPL8  <---------RVE1(2)  --------->At4g35610
--->RVE1(2) <---------YAB5--------->ARR11(3) <---------ZAT14----------->ARR10 <------ZmHOX2a(1)<----
 
caacaatcaataataatcaaagttatgaaaatctcggatttttaagagagtagtactctgatggagatcttgtgagattgaggagaaggatgagcttcgt  9225500
            --------->ZAT14
            <---------ZAT14
            <---------ZAT18
        <---------DEAR3(1)
   <---------DOF5.7(2)   <-----------HVH21
   --------->MYB52(1)    --------->At5g28300
 --------->DOF5.7(2) ------>NtERF2     <---------DOF5.7(1)
---------ZAT6       ----------->HVH21<---------ANAC58
--------TOE2(3)    <---------HSFB2a(2)<---------DAG2     <-------TEIL
--------TOE1(3)    --------->HSFB2a(2)<----------DOF2   <-----------GT1
-----MYB52(1) ------->TEIL           <---------ANAC58--------->ARR11(2)                 --------->ALFIN1
 
tagggttaacgacggtgtacttcccgacggtcattgaattgctttttatgtcttccgatatacattttgttcgaccagattgcaattcgaagtggagaga  9225600
                                                                                                   -
                                                                                        <----------DOF2
                                                                                       ------>ZmHOX2a(2)
                                                                                      <------ZmHOX2a(2)
                                                                                     --------->ARR11(3)
                                                                                     <---------GATA12
                                                                                     <---------ARR11(3)
                                                                                     --------->GATA12
                                                                                     <---------RVE1(2)
                                                   --------->ATHB12                  --------->AGP1-
                                                  <---------YAB5                    --------->GLK1(1)
                                                <---------ANAC58                    <---------GLK1(1)
                                      <---------ZAT14                     <----------DOF2        <--
                                      --------->ZAT14 ------>ZmHOX2a(2) <---------HSFB2a(1)     <---
                                  <---------------AtSPL8                --------->HSFC1(2)      <---
                       <------ZmHOX2a(1)        <---------ANAC58        <---------HSFC1(2)      <---
 
ttgagaaacttgtgatgaaatcgctaggaagagtagtattgtacagagattgagtgatcggagaaacatggtggaagctttgaagagagatctttggttt  9225700
                                                                                       --------->WOX13(2)
                                                                                       <---------WOX13(2)
                                                                                      --------->AHL12(2)
                                                                                     --------->AHL20(2)
                                                                                     --------->AHL25(1)
                                                                                     --------->AHL25(3)
                                                                                     <---------AHL25(1)
                                                                                     <---------AHL20(2)
                                                                                ------->MYC2
                                                                                <-------MYC3
                                                                                <-------MYC2
                                                                                ------->MYC3
                                                                                <-------MYC4
           <---------AtMYB61                                                    ------->MYC4
           --------->MYB111(1)                                                 <---------TGA1a
   ------>ZmHOX2a(2)                                                           <---------ANAC55(2)
 <---------RVE1(2)                                                             --------->TGA1a
-------->WRKY38(1)                                                             --------->ANAC55(2)
-------->WRKY12                                                                <---------O2
-----GAMYB<--------P                    --------->ARR11(3)   *TSS              <--------ABF1
------ANAC46        --------->CCA1(2)   <---------ARR11(3) <----------ID1      --------->O2     ----
------ANAC58<------MYB46(1)          >>>>>>>>>TBF1   <-------TEIL    <---------At4g35610 --------->YAB1
------ANAC58<------MYB83          >>>>>>>>>TBF1     <<<<<<<<<<<<<<<<<LFY  ----------->HVH21 <-------
 
cgttgatcgtggagttggtagagagatggaagacgaagaagaagaactcaacaacgtacaatggaacaagagagcttatgacacgtgtttaattttaact  9225800
                                                                                          <---------AHL12(3)
                                                                                          <---------AHL25(2)
                                                                                          <---------AHL20(2)
                                                                                          --------->AHL20(3)
                                                                                          <---------AHL20(3)
                                                     <----------DOF2                      --------->AHL12(3)
                                                  ------>NtERF2                           <---------AHL25(1)
        <-----------HVH21                        --------->WRKY12                  <---------ZAT6
       --------->O2                            <---------At4g35610                 ----------->GT1
       --------->ANAC46                  <---------ANAC58               <------NtERF2   <---------AHL12(2)
------->GT1            <----------DOF2   --------->ANAC55(2)          --------->ETT(1)  --------->AHL12(2)
----GT1<---------O2   <---------DOF5.7(1)<---------ANAC58  <----------DOF2  ----------->RAV1(1)
 
cgtgaaatacacgtcgaagaaactctctttctcatctagagttttcgtaacgctgactttgacttttagtatgtcgggacaacatagtgttatttttttt  9225900
                                      --------->ATHB51
                                      -------->HAHB4
                                      -------->ATHB1
                                      --------->ATHB12
                                      <---------AHL20(2)
                                      <---------ICU4
                                     <---------YAB5
                                     --------->ICU4
                                     <---------ATHB51
                                     <---------ATHB12
                                     <---------YAB1
                                    --------->WOX13(2)
                          <---------ANAC46
               --------->KAN1       <---------WOX13(2)
          --------->RVE1(2)       ------------>ATHB5
        ---------->DOF2   <---------ANAC58
     --------->ANAC58     --------->ANAC55(2)
     --------->AtLEC2     <---------ANAC58                                                      ----
     --------->ANAC58     <---------ANAC55(1)                          --------->ZAT6     <---------
    <-------MYC3          <---------ANAC55(2)                 <---------MYB52(1)        --------->AHL20(2)
    ------->MYC3        <-----------GT1                  --------->ANAC46           --------->ICU4 -
 
agtttcacatgcaaagctaaattctatttacgtgtgtctaattattggattccaaagtataagcagttgttttaagtctagttggcacttattaaacagc  9226000
                                                                                <---------AHL12(2)
                                                                               --------->AHL20(2)
                                                                               --------->AHL12(1)
                                                                               <---------AHL25(1)
                                                                               <---------AHL25(3)
                                                                               --------->AHL25(1)
                                                                               <---------AHL12(3) --
                                                                               <---------AHL12(1) <-
                                                                               <---------AHL20(2) <-
                                                                              --------->AHL20(2)  <-
                                                                              <---------AHL25(2)  <-
                                                                              <---------AHL25(1)  <-
                                                                              --------->AHL25(2)  --
                                                                              --------->AHL25(1)  --
                                                                              <---------AHL20(2) ---
                                                                              --------->AHL20(1) <--
                           <-----------GT1                                    <---------AHL20(1) ---
          <---------AHL20(2)                                                  --------->AHL25(3) <--
          --------->AHL20(2)    <-----------HVH21                             <---------AHL12(1) <--
      <------MYB83       <---------AHL20(3)                              <---------MYB59         ---
      ----------->GT1  --------->ICU4                                   --------->ANAC58         ---
      <------MYB46(1)  <---------YAB1                                   --------->ANAC46         <--
   <------ZmHOX2a(1)<---------ATHB12                                 <---------ARR11(2)          ---
  --------->DOF5.7(1)--------->YAB1       <---------DOF5.7(1)<---------AHL20(2)--------->AHL12(3)---
----->TOE2(3)     --------->WOX13(1)<---------O2     <---------GLK1(1)  --------->ANAC58         <--
--GT1 <---------MYB46(3) --------->AHL20(3)<----------DOF2 <----------DOF2    --------->AHL12(1) <--
--------->DOF2 --------->YAB5  <----------DOF2    <---------YAB1     --------->ARR11(2)  -----------
 
ctaaaaggatggtttaaatgtctatcatttttatctttcacatggcctttgttttgatttctcttttatttgtatacccaatttattttcaatagaaaaa  9226100
              <---------YAB1
         <---------KAN1
         <---------CCA1(1)
         <---------RVE1(1)
        <---------RVE1(2)
        <---------ARR11(2)
        <---------ARR14(2)
        --------->ARR11(3)
        <---------ARR11(3)
        --------->ARR14(2)
       <------ZmHOX2a(1)
     <---------------------WRI1
     <---------TOE2(3)
------->AHL25(1)
--------AHL25(2)
--------AHL25(1)
--------AHL25(3)                                                                              ------
--------AHL20(2)                                                                              <-----
--------AHL12(3)                                                                              ------
------->AHL12(3)                                                                             -------
------->AHL25(2)                                                                            --------
------>AHL20(2)                                                                             <-------
-------AHL25(1)                                                                             --------
------>AHL25(3)                               --------->ANAC58                              <-------
-------AHL25(3)                      --------->ANAC58                           <----------DOF2
-------AHL20(1)                     --------->At4g35610                         <---------DAG2------
------>AHL20(1)                    --------->MYB52(1)                  ------>ZmHOX2a(1)   <--------HAHB4
------>AHL12(3)                   <---------WRKY38(1)               <-----------GT1        ---------
-------AHL12(3)                 --------->ANAC46           <----------DOF2     <---------ANAC58
------>AHL25(2)            <-----------GT1    --------->ANAC58     <-----------GT1         <--------
------>AHL25(1)           <---------YAB1  <---------At4g35610   --------->AHL12(1)        --------->ICU4
-------AHL20(2)         --------->YAB1    --------->At4g35610   <---------AHL12(1)     <-------TEIL
-------AHL25(2)         <---------ICU4------->GAMYB       <---------ANAC58     <---------ANAC58  <--
>GT1 <---------TOE1(3) --------->ICU4--------->ANAC58     <---------ANAC58  ------>ZmHOX2a(1)<------
 
taaaatttgaggatattttcaatggaattataactaggcaacggaagctaagccagtatgtgcttgaatttttcctgtccttgctttatgtgcataatta  9226200
                                                    ------>ZmHOX2a(1)
                                                   --------------------->WRI1
                                                 <------ZmHOX2a(2)
                                                <---------ARR11(2)
                                                --------->ARR11(2)
--->YAB1                                        <---------ARR11(3)
----ICU4                                        --------->ARR11(3)
-->HAHB4                                        <---------ARR14(2)
-->ICU4                                         --------->ARR14(2)
->WOX13(2)                                     <------ZmHOX2a(1)
--AHL20(3)                                    --------->HSFC1(2)                         --------->ANAC58
->AHL20(3)                                    <---------HSFB2a(1)                        --------->ANAC46
--WOX13(2)                                    --------->HSFB2a(1)               <---------ANAC55(2)
--->KAN1                        <---------WOX13(2) --------->TOE2(3)          <-----------GT1  <----
>YAB5<---------WOX13(2)         --------->WOX13(2)------>ZmHOX2a(2)  --------->YAB5      --------->ANAC58
-ICU4--------->WOX13(2)     --------->RVE1(2) <---------HSFC1(2)    <---------KAN1     <-----------GT1
-------At4g35610       ----------->GT1 >>>>>>>>>CBP60g             ------->TEIL --------->ANAC55(2)
---YAB5           ---------->DOF2      >>>>>>>>>SARD1          --------->HSFB2a(2)<---------ICU4 ---
 
tgctgtcaaattgaagaacatgaaagttgaaaatcaattgaaatttggaaggatccttataagtatcgcgaacgtttattgttacttatttcacacaact  9226300
<- Previous    Next ->

AGI:  At1g26690.1   
Description:  emp24/gp25L/p24 family protein. similar to emp24/gp25L/p24 family protein [Arabidopsis thaliana] (TAIR:AT1G69460.1); similar to unknown [Populus trichocarpa] (GB:ABK93754.1); contains InterPro domain emp24/gp25L/p24; (InterPro:IPR000348); contains InterPro domain GOLD (InterPro:IPR009038)
Range:  from: 9224132    to: 9225762    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version