AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
            <---------DOF5.7(1)
           ------>ZmHOX2a(1)
           <---------------AGL15
           --------------->AGL15
     <-------MYC4
     ------->MYC2
     <-------MYC2
     ------->PIF5
     <-------MYC3
     ------->MYC3
     ------->MYC4
     <-------PIF5
    --------->TGA1a
    <---------ANAC55(2)
    <---------O2
    <<<<<<<<<<HY5
    --------->ANAC55(2)
    --------->O2                                                    --------->TOE1(3)
    <--------ABF1                                                   --------->TOE2(3)      ---------
    --------->bZIP60(2)                                             <---------MYB59   --------->LBD16
    <<<<<<<<<<AtMYC2                                            <---------ARR11(2)   ----------->GT1
    <---------TGA1a                                        --------->AtMYB61        <---------LBD16
    <<<<<<<<<<ABI5                      --------->At4g35610<---------ALFIN1        --------->MYB52(1)
   ------>NtERF2                        <---------At4g35610--------->DEAR3(1)     --------->ARR14(2)
  <---------ALFIN1                 <---------YAB5         --------->MYB46(3)      <---------ARR14(2)
 <------NtERF2                     <---------YAB1       <---------ICU4            <---------ARR11(2)
<-----------HVH21               --------->ICU4          <-----------GT1         --------->DOF5.7(1)
<-----------------PIF3(1)   ------>NtERF2               --------->YAB1        ---------->DOF2
------>NtERF2               ----------->RAV1(1)        --------->MYB46(3)   --------->ANAC58
-------->ANAC58            --------->ANAC46      <---------MYB46(3)<---------ANAC55(2)----------->GT1
-------->ANAC58            <---------ETT(1)     <---------ANAC46--------->ARR11(2)--------->ARR11(2)
-------->ANAC46--------->WOX13(2)--------->MYB52(1)    <---------YAB5       --------->ANAC58--------
 
acgcgccacgtgtcctcttattagcaaactccgacataatggtagccgagagcgggtaatcaccaccgatacctaaaccaagaaagaaccggaaaaaacc  7258300
                                        --------->ANAC58
                                        --------->ANAC58
                                  --------->ANAC46                       <---------YAB5
                                  --------->ANAC58  --------->DOF5.7(1)<---------ICU4
                                  --------->ANAC55(1)                  --------->YAB1              -
                                  --------->ANAC58---------->DOF2     --------->ICU4               -
                               <---------REM1(2)  --------->MYB52(1) <---------AHL20(3)            -
                             <---------ZAT18     ------->GAMYB       --------->AHL20(3)           --
                             --------->ZAT18     --------->AtMYB61  --------->YAB1                <-
                             <---------ZAT14   --------->ANAC58  --------->YAB1                  <--
                     <---------O2<---------LBD16--------->MYB46(3) <---------YAB1                ---
                     ============================bZIP_DOF        --------->YAB5                 ----
                     --------->TGA1a   --------->DOF5.7(1)    --------->YAB1                    <---
                     ============================bZIP_DOF   <---------TOE1(3)                   ----
                     <---------TGA1a   --------->DAG2       <---------TOE2(3)                <------
     --------->TOE1(3)       --------->ZAT14   --------->ANAC58<---------ARR11(3)        --------->KAN1
     --------->TOE2(3)   <---------AtMYB61   --------->MYB46(3)--------->ARR11(3)     --------->LBD16
     --------->YAB1  ====================================MYC_MYB<------ZmHOX2a(2)    <---------ANAC46
>DOF5.7(1)       --------->DEAR3(2)   ---------->DOF2   --------->At4g35610         <---------------
->MYB52(1)--------->ZAT6 --------->ALFIN1  --------->RAP2.6(2)<------ZmHOX2a(1)---------->DOF2 <----
 
gaggctaaccataacacaagaccgacgagtggtgcacacggaaaagccacaaccaaaggagctaaggatcataataatcaaacaaagtccgtagactcgg  7258400
     ------>MYB83
     ------>MYB46(1)
   ------->GAMYB
   --------->DREB2C(2)
   ===============================================MYC_MYB
  --------->DEAR3(2)
------>NtERF2
---------->HVH21
-------->DEAR3(1)                        --------->LBD16
-------->MYB46(3)                       ===========================bZIP_DOF
------->ATERF1(1)       ==========================MYC_MYB         <---------ANAC58
-----NtERF2 <---------WRKY12            --------->O2              <---------ANAC46              <---
-------ATERF1(1)        ------->GAMYB   ===========================bZIP_DOF                    <----
--->NtERF2  <---------WRKY38(1)    --------->WRKY12               <---------ANAC58            ------
------->HVH21        --------->ARR11(2) <---------O2           <---------DEAR3(1)         --------->ALFIN1
------DEAR3(1)       --------->MYB52(1) --------->TGA1a  --------->DAG2            --------->RAP2.6(3)
----->DEAR3(1) --------->DEAR3(1)  ----------->HVH21------>NtERF2<-----------------------TaNAC69(2)
---DEAR3(1)----------->HVH21       --------->WRKY38(1)  ---------->DOF2           --------->MYB52(1)
--------TaNAC69(2)   <---------ARR11(2) <---------TGA1a<---------KAN1         ---------->DOF2<------
--NtERF2  <-----------HVH21 --------->ZAT6         <---------ANAC46<---------SPL7(1)   <---------DEAR3(1)
 
cgacgaccgactcggtcaccgaggtaaccgaagactagttgacccgtggctgtgccgagtaaagcgatggcgtaagaagttgaaagaacggctgtgttga  7258500
                                                                      --------->At5g28300
                                                                     ----------->GT1
                                                                     <---------DEAR3(2)
                                                                    <---------DEAR3(1)
                                                                  <-----------HVH21
                                                                 <---------ANAC58
                                                              <---------ARR11(2)
                           <---------ICU4                     --------->ARR11(2)
                           --------->YAB1                   <---------SPL7(1)
                           <--------HAHB4                  ------>ZmHOX2a(2)                       -
                          <---------YAB5                  <------ZmHOX2a(2)                     ----
      <-------GAMYB       <---------ATHB12               <---------GATA12                      <----
   <---------At5g28300    --------->ICU4                 --------->ARR11(3)             --------->LBD16
------WOX13(1)      --------->YAB5  <---------WRKY18(1)  <---------ARR11(3)            --------->ANAC58
-----WOX13(2)    --------->YAB1    ----------->HVH21   --------->DOF5.7(1)             --------->ANAC58
--->ATHB12       <---------ICU4  --------->YAB1--------->AtLEC2  <---------ANAC58     <---------LBD16
---YAB1     --------->WOX13(2)   <---------AtLEC2    ---------->DOF2<---------At1g77200--------->ANAC46
 
ttgagtcaccgttgtaataaacatgactaatcattttcatgaccggtgctatgcagaaaagatcgtatgcgtcggtgaatagacccattcccgctactat  7258600
                                                                                                   <
                                                                  <------MYB46(1)                 <-
                                                                 <---------TOE1(2)           -------
                                                   <----------DOF2<---------MYB46(3)     --------->GATA12
                                                   <---------DAG2<---------TOE2(2)       <---------GATA12
                                                  --------->TOE2(3)                      --------->RVE1(2)
                                                  --------------->AGL15                  <---------ARR11(2)
                                                  <---------------AGL15                  --------->ARR11(2)
                                                 ----------------->AG                    --------->GLK1(2)
                                                 ----------------->AGL1                  <---------ARR14(2)
                                    --------->ANAC58            <---------MYB52(1)       --------->ARR14(2)
                                    --------->ANAC58          --------->ATHB12     --------->GLK1(2)
  <----------DOF2                   --------->ANAC46         <------NtERF2         <---------ARR11(2)
----->ZmHOX2a(2)                  ---------->DOF2<-----------------AGL1            <---------ARR14(2)
----->YAB1                     --------->REM1(1)<---------ARR11(3)<------MYB83   --------->KAN1   <-
-----YAB1     <---------YAB1  <-------TEIL------>NtERF2      <---------YAB5 <---------At4g35610   <-
 
gatcgctttgaaatggtaccattgtgttcgagctacatcaagcgacgacaatacctttatcggcatcgttggtttttttatctgagattccgaatccaga  7258700
                                                                                              ------
                                                                                             -------
                                                                                          --------->YAB5
                                                                                         --------->ICU4
                                                                                         <---------YAB1
                                                                                       <-----------GT1
                                                              ----------->GT1     <----------DOF2
                                                            <---------YAB1       --------->YAB5
                                                          <---------ICU4         ------>ZmHOX2a(2)
                                                          --------->YAB5         <---------DOF5.7(1)
                         <----------DOF2                 <---------YAB1         <------ZmHOX2a(2)
  <------------------------ANAC81            --------->HSFC1(2)                --------->ARR14(2)
 <------------------------ANAC81 --------->MYB52(2)      --------->ICU4        <---------ARR11(3)
---------DOF5.7(1)  <----------DOF2          --------->HSFB2a(1)               --------->ARR11(3)
--------DOF5.7(1)  <---------DOF5.7(1)       <---------HSFC1(2)                --------->GLK1(2)
-->LBD16 <------------------------ANAC81     <---------HSFB2a(1)               <---------ARR14(2)
--------DAG2    <---------ANAC58 <---------MYB46(3)    --------->YAB1          <---------GATA12
---------DOF2   <---------ANAC58 ----------->GT1     <---------KAN1            --------->GATA12
 
gctttttttttttttttttgcttctttccttttggtttgttatatcgaaatttcgaattcatgatgagtgaaacagaacaaggatctttataacgattaa  7258800
                                                    --------->ARR11(3)
                                                  <---------YAB5
                                                  <---------YAB1
                                            <---------YAB1
                                          --------->KAN4(1)
                     <----------DOF2      <---------KAN4(1)
        ---------->ID1                    --------->KAN1
    <----------DOF2  <---------DAG2       <---------KAN1          <------ZmHOX2a(1)              <--
   <---------DOF5.7(1)  <------------CBF ---------->TaMYB80    --------->HSFB2a(2)          <-------
--->YAB1<---------YAB5 --------->ATHB12  <---------KAN4(2)     --------->LBD16  <---------MYB52(1)<-
-->AHL20(2)   <---------YAB1       <---------AtLEC2 <---------RVE1(2)       <---------YAB5  --------
 
taagtctctttgtcattttcattactttattggtatgagcatggaatatgcttatgattttgactccgaggaagacttagtcagtttgtttgtaagagct  7258900
                                                                          --------------->AtSPL3
                                                                         --------->ZAT14
                                                                         <-------TEIL
                                                                      <---------MYB46(3)
                                                               <-----------GT1
                                                             <---------AHL25(1)
                                     <---------YAB5          <---------AHL25(3)
                                   <---------ICU4            --------->AHL20(2)
        <-----------RAV1(1)       --------->ICU4             --------->AHL25(1)
    <<<<<<<<<GATA-1               <---------YAB1 <-----------GT1      <---------DEAR3(2)
   <-----------GT1   <---------TOE2(3)         --------->AHL12(1)    <---------DEAR3(1)
-------DOF5.7(1)    ---------->DOF2--------->ATHB51        --------->WOX13(2)
--ARR11(3) <---------bZIP60(1)  --------->YAB1<---------AHL12(1)    <---------MYB52(1)
---------DOF2 <-----------------AGL1<------------CBF       <---------WOX13(2)
->ARR11(3) --------->bZIP60(1) <---------YAB1 --------->AHL12(1)   <-----------HVH21
 
tctttttatctatgttgtcacattaaggcacaacatcataattgtttgaatttttctagccaaattaaaccgtcggttcagtactgttttagtttcggtt  7259000
                                              --------->ZAT6
                                            ----------->RAV1(1)
                                         --------->ANAC46
                                      --------->MYB52(1)
                                   --------->ANAC58                        <---------ARR14(2) ------
                                   --------->ANAC58                        --------->ARR11(2) ------
                                   --------->ANAC55(1)                     <---------RVE1(2)  <-----
                                   --------->ANAC46  ----------->RAV1(1)   <---------ARR11(2) ------
                          <---------MYB111(1) <---------ALFIN1             --------->ARR14(2) ------
                   <---------ZAT14 <---------ANAC55(2)                     <---------GLK1(2) <------
            --------->CCA1(2)      --------->ANAC55(2)                <-----------GT1        <------
  <---------ANAC55(2) --------->At5g28300------->GAMYB                --------->MYB52(1)     <------
  --------->ANAC55(2)----------->GT1<---------MYB52(2)             --------->YAB1            -------
 
tgatcacttattgagaaatgagaacagtaactactaacaagtaacagcaacactgccaacacagaaacaatattaacggattctcagtttgatgaaatca  7259100
                                           ==================bZIP_DOF
                                           --------->ANAC58
                                           <---------ANAC55(2)
                                           --------->ANAC58
                                           <---------O2
                                           --------->ANAC55(2)
                                           --------->bZIP60(1)
                                           --------->O2
         <---------RVE1(1)                 <---------TGA1a
      ----------->GT1                      --------->TGA1a
   --------->MYB52(1)   --------->AtLEC2   <---------bZIP60(1)
--->YAB5 <---------KAN1 --------->ANAC58   ==================bZIP_DOF
--->YAB1 --------->GLK1(1)             <-----------HVH21        <-----------GT1
----ICU4<---------RVE1(2)     <---------ARR11(3)            --------->ARR11(3)
--->ATHB12              --------->ANAC58   --------->bZIP60(2) --------->KAN1
-->ATHB1--------->ARR11(2)    <---------GATA12              <---------ARR11(3)    <---------RVE1(2)
---ATHB12<---------CCA1(1)    --------->GATA12          ---------->DOF2<---------ANAC58
---YAB5 <---------ARR11(2)    --------->ARR11(3)   --------->DAG2      <---------AtLEC2
---YAB1 <---------ARR14(2)    --------->GLK1(2)   ---------->DOF2      <---------ANAC58 <----------DOF2
-->ICU4 --------->ARR14(2)    --------->RVE1(2) ------>ZmHOX2a(1)<---------YAB1  --------->KAN1
 
ttgtgaaaacggatatttagcaaaatcatgcaaaatctacagagtcacgtcctaaaagtaaaagatttatccttgcatgctgtttgattcgctttccttc  7259200
<- Previous    Next ->

AGI:  At1g20860.1   
Description:  phosphate transporter family protein. Identical to Inorganic phosphate transporter 1-8 (PHT1-8) [Arabidopsis Thaliana] (GB:Q9SYQ1;GB:Q1PFU6); similar to phosphate transporter family protein [Arabidopsis thaliana] (TAIR:AT1G76430.1); similar to General substrate transporter [Medicago truncatula] (GB:ABN06033.1); contains InterPro domain Major facilitator superfamily MFS-1 (InterPro:IPR011701); contains InterPro domain Major facilitator superfamily; (InterPro:IPR007114); contains InterPro domain Sugar transporter, conserved site; (InterPro:IPR005829); contains InterPro domain MFS general substrate transporter (InterPro:IPR016196)
Range:  from: 7253996    to: 7258666    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g20870.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54850.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO66281.1); contains InterPro domain HSP20-like chaperone (InterPro:IPR008978)
Range:  from: 7259091    to: 7260764    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version