AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            --------->LBD16
                            ------>NtERF2
                           --------->ANAC46                <---------KAN1
                      <---------GATA12                    --------->RVE1(2)
                      <-----------ARR10              --------->ANAC58
       <---------At4g35610<---------LBD16            --------->ANAC46   --------->HSFC1(2)
    <-------TEIL      --------->GATA12               --------->ANAC58   <---------HSFC1(2)
 --------->YAB5      <---------CCA1(2)            ------->GAMYB         <---------At4g35610
<---------ATHB12 --------->TOE1(1)        --------->At4g35610           --------->At4g35610    -----
----->MYB46(3)  ------>ZmHOX2a(1)         <---------At4g35610  --------->MYB46(3)             ------
----GATA12      XXXXXXXXXXXXXXXXXXXX>MIR780.2  ----------->RAV1(1)<---------GATA12 <------ZmHOX2a(1)
--->GATA12  ------>ZmHOX2a(1) --------->DEAR3(1) <---------ALFIN1 --------->RVE1(2)=================
 
ccactgattcatctccttcctcgtaaatctccgccatcgaaatttagctccaacacacgcgaatcaacaaatcgaagcttacacgaggaagacaacgtaa  7216700
                                                          <---------WOX13(2)
                                                          --------->WOX13(2)
                               <---------ARR11(2)        --------->WOX13(1)
                              <---------KAN1           ------------>CBF    --------->RVE1(2)
 <------ZmHOX2a(2)           *TSS                   <---------AHL12(1)   ---------->DOF2
<---------GATA12 <------ZmHOX2a(2)                  --------->AHL12(1)------------>CBF
---->DAG2       --------->RVE1(2)                  --------->ICU4 --------->DOF5.7(1)              <
---->DOF2      --------->At4g35610            --------->YAB1    ---------->DOF2                  ---
========HOX2a_HOX2a      --------->HSFB2a(2)  --------->ANAC55(2)--------->DOF5.7(1)            ----
 
agcgatcgaaacagagacagatcaatttctcgagtaaacgaggctattttcgtaatatttcaattagtaaaggcccaatagcccaagtagaagacaacgt  7216800
                                                      --------->DOF5.7(1)
                                                     ---------->DOF2
                                                     <---------ICU4
                                                   --------->WOX13(2)
                                                   <---------WOX13(2)
                                                 --------->AHL25(1)
                                                 --------->AHL20(2)
                                                 <---------AHL20(2)
                   <------ZmHOX2a(2)            --------->AHL20(2)                                 <
          ---------->DOF2                       <---------ATHB12--------->YAB1                     <
   <------ZmHOX2a(2)                           <---------WOX13(2)                                  <
  <---------GATA12--------->RVE1(2)            --------->WOX13(2)        --------->RVE1(2)      <---
---------------------WRI1                 --------->RVE1(2)    <---------ICU4                  <----
------>DAG2       <---------GATA12  --------->ANAC55(2)--------->DOF5.7(1)                  <-------
------>DOF2 --------->DOF5.7(1)     --------->YAB1 <---------AHL12(2)  ---------->DOF2 --------->YAB5
 
aaagcgatcgaaacaaagacggatcaaacgaggctattttcgtaatatccaattaataaaggcccattaataccaatagcccaagtcgaaagattacctc  7216900
                           <---------ANAC46
                           <---------ANAC58
                           --------->ALFIN1
                           <------MYB46(1)                                                         <
                           <---------ANAC58                                                        -
                           <------MYB83                                                            -
                          --------->MYB111(2)                                                      -
                          <---------DEAR3(1)                                                       -
                          <---------AtMYB61                                                        <
                          <---------MYB46(3)                                                       -
            <---------ARR14(2) <------MYB83                                                       <-
            --------->ARR11(2) <------MYB46(1)                                                   ---
            --------->ARR14(2)<---------MYB46(3)                                                 <--
   --------->WRKY18(1)    --------->MYB55(2)                                                     ===
  <-----------HVH21       --------->MYB46(2)               --------->ANAC46                      <--
---------ANAC46           --------->MYB111(1)  <---------KAN1                                    ===
---------ANAC58          --------->ALFIN1      --------->ALFIN1------>NtERF2                   <----
---------ANAC58 --------->YAB5--------->MYB111(1)--------->ALFIN1                              <----
-------DOF2 <---------ARR11(2)--------->MYB55(2) <---------ANAC58       <---------MYB52(1)     <----
-----DOF5.7(1) <---------YAB1--------->ALFIN1<---------ANAC46--------->At4g35610  <---------MYB52(1)
----------AG<---------MYB52(1)--------->MYB111(2)<---------ANAC58<-----------RAV1(2)          <-----
 
tttcgggtcaaaccggttatgtttatgggtgggtgggtagagcaagtcgagtgtgtgtgaacacagcgccaggctgtttgtctcagtttgtcaagttggc  7217000
          --------->ANAC46
          --------->ANAC58
          --------->O2
          --------->TGA1a
          --------->ANAC58
          ==========================================bZIP_DOF
          <---------O2
          <---------TGA1a
     <---------TCP20
     --------->ARR11(2)
     <---------ARR11(2)
     <---------TCP16(1)
    <------NtERF2
    --------->ATERF1(1)
   <---------ATERF1(1)
   <---------MYB46(3)
<------MYB83
<---------ANAC58
<------MYB46(1)
<---------ANAC58
---------AtMYB61
-------->MYB52(2)
-------->MYB55(2)
-------->MYB111(2)
-------->MYB46(2)                                                   <----------DOF2
---------MYB46(3)                                                  <---------ANAC58
-------->MYB111(1)                       <---------DAG2        <---------ANAC58
--------MYB55(1)                         <----------DOF2       <---------ANAC46
-------------------->TaNAC69(2)    --------->O2                <---------ANAC58
-------MYB52(1)                    <---------TGA1a         <---------DOF5.7(1)
====================MYC_MYB        <---------O2<---------RVE1(2)   <---------ANAC58
-----GAMYB--------->bZIP60(2)      --------->TGA1a         <---------DAG2
=============================================MYC_MYB   <---------WRKY38(1)
-----ANAC58                        =================bZIP_DOF<----------DOF2           <---------RVE1(2)
-----ANAC46                        ============================================bZIP_DOF <---------DOF5.7(1)
-----ANAC58                        --------->ANAC55(2)--------->WRKY18(1)       --------->KAN1
-NtERF2 <---------ALFIN1           ====================================bZIP_DOF --------->AHL12(1)
 
gtttggtggctccacgtctctctctatctctctctctcacatgacttttcgattttagtcaacctttcgtgcttttctcttaaaaattcgattttttctt  7217100
                                                                                                  --
                                <-----------GT1                                                   <-
                              <---------DOF5.7(1)                                --------->ARR11(3)
                             <----------DOF2                     --------->RVE1(2)               ---
                             <---------DOF5.7(1)        <-------PIF5             <---------ARR11(3)
                   <-----------GT1    <---------CCA1(2) ------->PIF5             <---------GATA12---
                *TSS         <---------DAG2       <---------HSFB2a(2)     --------->At4g35610 <-----
               <---------MYB52(1) ----------->RAV1(2) <---------LBD16     --------->ZAT2   <------ZmHOX2a(1)
    <---------DOF5.7(1)------>ZmHOX2a(1)          --------->HSFB2a(2)     <---------ZAT2   =========
 
caacccatcttcttctctgttatttcctctcgcttttacctgtctctctcgttctcgcacggggatagaatcaactctgctcgagattttagtaggaggc  7217200
                    <-------TEIL
                   <------ZmHOX2a(2)
                  <---------ARR11(2)
                  --------->ARR11(2)
                  --------->AGP1
       <---------ANAC58
       <---------ANAC58                             <---------TOE1(2)
  --------->ATHB12--------->GATA12                  --------->LBD16
------->ZAT2      <---------GATA12                 <---------ANAC46    <---------ARR11(3)
--------ZAT2    --------->MYB59             <----------DOF2            <---------RVE1(2)
------>ANAC58<---------WOX13(2)    --------->ARR11(3)        <---------At4g35610
------>ANAC58--------->WOX13(2)    <---------ARR11(3)   <---------DOF5.7(1)         --------->ALFIN1
-NtERF2<---------ANAC46         >>>>>>>>>TBF1     <---------LBD16      --------->ARR11(3)
==========================HOX2a_HOX2a    <---------ALFIN1    --------->At4g35610    <---------AtMYB61
 
aagctcgattgcttgcaattagatccatggatgaagaagaactcacactttctcgcgcgtttttagctcaaggagatttttgaagaagtggtcgttttcg  7217300
                                                                                                 <--
                                                                 --------->ATERF1(1)            <---
                                                                 <------NtERF2              <-------
                                                                <---------DEAR4(2)         <--------
                        <----------DOF2                         <---------ATERF1(1)        <--------
                  --------->RVE1(2) <----------DOF2            --------->ALFIN1            <--------
              >>>>>>>>>TBF1<------------------------ANAC81     <---------DEAR3(1)        <------MYB46(1)
          --------->At4g35610    <-----------GT1              <------ZmHOX2a(1)          <------MYB83
          <---------At4g35610 <---------DOF5.7(1)       <----------DOF2 <---------------AGL15   <---
 
aattgtcaacttcagaagaagaatcaactttggttttttcttttcccttctctgtatagctttgaggaggcgcttcttcaactggaacaggctggtgtgc  7217400
                                                                                               -----
                                                                                               <----
                                                                                              <-----
                                                                                              <-----
                                                                                    <------MYB46(1)
                                                                                    <------MYB83
                                                                                   --------->MYB59
                                                                                <---------WOX13(2)
                                                                                --------->WOX13(2)
                                                                             --------------->AGL15
                                                                             <---------------AGL15
                                                                            ----------------->AG
                                                                            <-----------------AG
                                                                            ----------------->AGL1
      <-----------GT1                                                       <-----------------AGL1
     <-----------GT1                                                        ========================
-------DOF5.7(1)                                                            ========================
------DAG2                                                                  <-----------------AGL2
--ZAT18                                                                     <-----------------AGL3
-ANAC58                                                  <---------ARR11(3) ----------------->AGL3
-ANAC46   <---------DOF5.7(1)                         <----------DOF2  <---------KAN1         ------
-ANAC58<-----------------AGL1                 <-----------GT1          <---------KAN4(1) <---------YAB5
-------DOF2<----------DOF2                <---------MYB52(1)<----------DOF2 ----------------->AGL2
 
ttttttttttatctcttttggtatttttgaaatgcttcatgagacgttgtttctcttctttatctttttgacgaatattgctaaatttggtaatcttgct  7217500
                                                  <---------TOE1(3)
                                                  <---------TOE2(3)
      <-------TEIL                                --------->MYB59
---------->AGL15                          <---------ANAC58       <---------WOX13(1)
-----------AGL15                          <---------ANAC46     --------->YAB5
------------AGL2  <---------YAB1          <---------ANAC58     --------->ATHB12                  ---
------------AGL3  <---------YAB5         ---------->ID1       <---------YAB1                   -----
===========MADS_MADS--------->ARR11(3)<----------DOF2         <---------YAB5                  ------
============MADS_MADS                 <---------DAG2          --------->ICU4           <---------ANAC58
----------->AGL3  --------->ICU4  <---------MYB52(1)    <---------YAB1                 <---------ANAC58
 
atataagggttcatgggagtgatgattttgggacactgttacttttcgtattttaggttatagttatgattgaaagtttgaattttgtttccttggctgt  7217600
<- Previous    Next ->

AGI:  At1g20770.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN80128.1)
Range:  from: 7215004    to: 7216730    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g20780.1   
Description:  armadillo/beta-catenin repeat protein-related / U-box domain-containing protein. similar to armadillo/beta-catenin repeat family protein / U-box domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G76390.1); similar to armadillo/beta-catenin repeat family protein / U-box domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G76390.2); similar to unknown protein [Oryza sativa (japonica cultivar-group)] (GB:AAP50990.1); similar to armadillo/beta-catenin repeat family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] (GB:ABA97086.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO66256.1); contains Inter
Range:  from: 7217117    to: 7220773    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version