AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
                                                                                               <----
                                                                                             -------
                                                                                          --------->ANAC55(2)
                                                                                          <---------ANAC58
                                                                                          <---------ANAC58
                                                                   --------->DOF5.7(1)    <---------ANAC46
                                                       ------>ZmHOX2a(2)                  <---------ANAC55(2)
 ----------->GT1                                     <-----------ARR10                    <---------ANAC55(1)
--------->DAG2                                       --------->ARR11(3)       --------->ANAC46 -----
--------->DOF2               <-----------GT1         <---------ARR11(3)----------->GT1   <----------
-->YAB5           <---------YAB5               <---------ALFIN1  ---------->DOF2    --------->AHL20(2)
 
taaaaagtaacaagtagtagcatcatccaatataacttcatctaaatgacacacatgatcttacctccaaaagatggtaacacatcatataatacgtgta  7029200
                                                                     --------->AHL20(3)
                                                                     <---------AHL20(1)
                                                                     <---------AHL20(3)
                                                                     <---------AHL12(2)
                                                                     --------->AHL20(1)
                                                                     --------->AHL25(2)
                                                                     --------->AHL12(1)
                                                                     <---------ARR11(3)
                                                                     --------->ARR11(3)
                                                                     <---------AHL12(1)
                                                                     <---------AHL25(2)
                                                                     <---------AHL25(3)
                                                                    --------->AHL25(1)
                                                                    <---------AHL25(1)
                                                                    <---------AHL12(3)
                                                                    <---------AHL12(1)
                                                                    --------->AHL25(3)
                                                               <---------MYB52(1)
                                                           <---------At5g28300
                                                          <-----------GT1      <-----------RAV1(1)
                                                       --------->WOX13(2)  <---------YAB1
                                                      ------->TEIL<---------AHL12(2)
                                                   <---------ANAC58 <---------AHL20(2)
  <---------KAN1                                   --------->ANAC55(2)  <---------AHL20(2)
-------->YAB5                                      <---------ANAC58 --------->AHL12(1)
-----ARR11(2)                                      <---------ANAC46 --------->AHL12(3)
-->REM1(2)  --------->YAB1                        ---------->ID1  --------->AHL12(2)   --------->ANAC58
---->ARR11(2)<---------TOE2(3)                <----------DOF2----------->GT1  <---------YAB1       -
-------------TaNAC69(2)         --------->GLK1(2) <---------TOE2(3)--------->AHL25(3)  --------->ANAC58
 
aacgactatgtgttataatgttatctatccatgaaattctgagttctgactttgacgtatttaaccgttaaatattttcttattgttggcaggcaatagt  7029300
                                                                                            --------
                                                                                        --------->YAB1
                                                                                        --------->YAB5
                                                                                       <---------YAB5
                                                                                  ------>ZmHOX2a(2)
                           --------->YAB5                                        --------->CCA1(2)
                           --------->YAB1                                        <------ZmHOX2a(2)
                           -------->HAHB4                                       <---------GATA12
                           --------->ATHB12                                     --------->GATA12
                           <---------ICU4                                       <---------ARR11(3)
                          --------->ICU4                                        <---------AGP1<-----
                          <---------YAB1                                        --------->ARR14(2)
                        --------->YAB1                                          --------->RVE1(2)
                <---------ANAC58   --------->CCA1(2)        --------->ANAC46    <---------ARR14(2)
                <---------ANAC58<---------YAB1            <-----------GT1       --------->ARR11(3)
       --------->At4g35610<---------YAB5               <---------DOF5.7(1)      <---------RVE1(2)
    <---------YAB5      <---------ICU4                 <----------DOF2          --------->AGP1------
-------->ANAC55(2)    <---------RVE1(2)       <----------DOF2                 ----------->ARR10
 
ttacataatcagttgaatttcgttcgataatgattacgatatgaagagacttttccgacttttactccataacttatacataagatctgaatcataaggt  7029400
                                                                                                   <
                                                                                          <---------AHL20(2)
                                                                                        --------->AHL12(3)
                                                                                        <---------AHL12(3)
                                                                                        <---------AHL20(2)
                                                                                        <---------AHL25(2)
                                                                                        --------->AHL12(2)
                                                                                       --------->AHL12(2)
                                                  --------->ATHB12                     <---------AHL12(2)
                                                <---------TOE1(2)                     <---------AHL20(2)
                                               ------>ZmHOX2a(1)                      --------->AHL12(3)
                                         <------MYB46(1)      <---------WOX13(2)      --------->AHL12(1)
                                         <------MYB83         <---------AHL12(2)      <---------AHL12(1)
                                         <---------ATERF1(1) <---------AHL20(3)       <---------AHL25(1)
                                       <--------P<---------YAB1   ---------->DOF2    --------->AHL20(1)
                                      <---------ANAC58       <---------AHL20(2)      --------->AHL25(3)
                                      <-------GAMYB          <---------AHL12(3)      <---------AHL20(1)
           --------->YAB5             <---------ANAC58       --------->AHL12(3)     <---------AHL20(2)
    ---------->DOF2                  <---------MYB46(3)      --------->AHL20(3)     --------->AHL12(3)
   <---------AHL20(2)                <------MYB46(1)        --------->AHL25(3)    --------->AHL20(2)
->DAG2    <---------KAN1             <------MYB83<---------ATHB12<---------AHL20(2) <---------AHL12(3)
----ARR11(3)           <---------RVE1(2)<---------DEAR3(1)  --------->AHL20(2)    --------->AHL12(3)
--->ARR11(3)         <-------TEIL   --------->MYB59<---------RVE1(2)    <---------YAB1<---------AHL12(3)
 
ctatatataaagaatgtttcatggtacatattgaacaatttggttggctcctatgatttgctataaatttaaagtctcattgcatatatatattttttgg  7029500
                                             ------>NtERF2
                                            --------->DEAR3(1)
                                          <---------ATERF1(1)
                                          <---------RAP2.3(1)
                                          ------>NtERF2
                                         --------->DEAR3(1)                               <---------ICU4
                                         --------->ANAC46                                 --------->YAB5
                             --------->CCA1(2)                                            <--------ATHB1
                             --------->KAN1<------NtERF2                                  --------->KAN1
                             --------->GLK1(1)                                           <---------ATHB12
                             <----------TaMYB80                                ---------->ID1
                             <---------GLK1(1)                                <-----------GT1    <--
                             <---------KAN1--------->RAP2.3(1)       --------->ANAC58    <---------ATHB51
                  <---------ARR11(3)     <---------DEAR3(1)          --------->ANAC58------------>CBF
                  --------->ARR11(3)  --------->ANAC46          --------->ANAC58 <---------DOF5.7(1)
                 <---------KAN1  --------->ANAC46       --------->ATHB12  <---------GATA12--------->ATHB51
     --------->ANAC58       <---------RVE1(2)--------->At4g35610--------->ANAC58 <---------DAG2  ---
     --------->ANAC58       --------->ARR11(2)         <-------TEIL---------->DOF2<----------DOF2<--
---------YAB1<---------YAB1 ---------->TaMYB80     <---------At4g35610    <---------ARR14(2)     ---
 
ttattagtaagaaattacgaatatatacagggatatactaaacgacgccgcttcagcattcatttggaagcaaagcaaatttgaccttttcaataattcg  7029600
                                                                                          <---------ANAC58
                                                   --------------->AGL15                  <---------ANAC58
                                                   ==============================================MADS_MADS
                                                   <---------------AGL15                  <---------ANAC46
           --------->ZAT14                        <-----------------AGL2         --------------->AGL15
           <---------ZAT18                        ================================================MADS_MADS
           <---------ZAT14                <---------ZAT2                         <---------------AGL15
           --------->ZAT18                --------->At4g35610                   <-----------------AGL3
      --------->DOF5.7(1)                 <---------At4g35610              --------->ARR11(3)
-------ARR11(2)                       <---------ALFIN1                     --------->RVE1(2)
------>ARR14(2)               --------->AtMYB61   ----------------->AGL3   <---------ARR11(3)
-------ARR14(2)    ---------->ID1   <---------ALFIN1                       --------->GATA12  -------
------>ARR11(2)   *TSS------>ZmHOX2a(1)   --------->ZAT2                  <---------GLK1(2) <-------
 
tattcacataagagtgaacttcgtccttcttcaccatcgccactctgctccgttctacatttagaagagactgaccaaaatctcccattaatggcgttac  7029700
                                   <---------At4g35610
                                   <---------CCA1(2)
                          <----------DOF2
                         <---------DOF5.7(1)
                  --------->HSFB2a(2)
  --------->YAB1  <---------HSFC1(1)
 <------ZmHOX2a(2)--------->HSFC1(1)                             --------->ZAT2
--------->RVE1(2) <---------HSFB2a(2)     ------>ZmHOX2a(1)    <---------ALFIN1              -------
-->KAN1       <----------DOF2 --------->TOE2(3)  --------->ANAC46<---------ZAT2  <---------REM1(2) <
--MYB52(1)   <---------DOF5.7(1) --------->REM1(1) --------->ANAC46   <------NtERF2    ----------->HVH21
 
tccgatcaaaactccatctttctcgaaccctttccttcatctctcctcttctacccaaaaccttctccacctcggcaacttctctactcagtgaccatga  7029800
                          --------->DEAR3(1)
                          --------->ATERF1(2)
                          --------->RAP2.6(2)
                          --------->RRTF1(3)
                          <---------DEAR3(1)
                          --------->RAP2.3(3)
                          --------->RRTF1(2)
                          --------->DREB2C(2)
                         --------->RRTF1(1)
                         --------->ATERF1(1)
                    <---------ARR11(2)
                    <---------ARR14(2)
                    --------->MYB52(1)
                    --------->ARR11(2)
                 --------->AtMYB61
               ------>NtERF2
               ----------->RAV1(1)
              <---------ALFIN1
              --------->DEAR3(1)
             --------->ERF1
             --------->ATERF1(1)
            --------->ABI4(1)
            <---------ATERF1(1)
            ------>NtERF2--------->DEAR4(2)
           --------->ANAC46------>NtERF2
           --------->RAP2.3(2)
           --------->DREB2C(2)
           --------->ANAC58--------->ABI4(1)
           --------->RRTF1(3)
           --------->ANAC58<---------ATERF1(1)
           --------->RAP2.3(3)
           --------->RRTF1(2)
           --------->DEAR3(1)
           --------->RAP2.6(2)
           --------->ATERF1(2)
           <---------ATERF1(2)------>NtERF2
          --------->RAP2.3(1)--------->RAP2.3(2)
          --------->ERF1 --------->RAP2.6(1)
          --------->RAP2.6(1)--------->RAP2.3(3)
          --------->RRTF1(1)--------->DEAR4(2)
          --------->ATERF1(1)--------->DEAR3(1)
          --------->ORA47(2)<------NtERF2
         ------>NtERF2   --------->RAP2.3(1)
         <---------ATERF1(1)--------->ATERF1(1)
         --------->LBD16 --------->ORA47(2)
        --------->ANAC46 --------->ERF1
      <---------KAN1--------->ARR14(2)
     ------->TEIL--------->YAB1
     --------->ARR14(2) <---------ATERF1(1)
     <---------ARR14(2)------->GAMYB                                  --------->ANAC46
     --------->ARR11(2)--------->ANAC46                               --------->ANAC58
     <---------GATA12 --------->MYB46(3)                              --------->ANAC58            <-
     <---------ARR11(2)--------->DEAR3(1)                       --------->SPL7(1)                <--
     --------->GATA12 --------->DEAR3(2)  <-----------ARR10   --------->LBD16                    <--
     --------->GLK1(2)<------------AtMYB77--------->RVE1(2)  <---------HSFB2a(2)               -----
xxxxxxxxxxxxxxxx>smallRNA(s)--------->RAP2.3(1)              --------->HSFB2a(2)    --------->DAG2--
-->AtLEC2--------->At4g35610--------->ORA47(2)              <---------LBD16        ---------->DOF2--
----------ID1<------NtERF2--------->RAP2.3(2)         <---------MYB52(1)     ----------->GT1 <------
 
aaacgacgaatccgccgccaccataaccgccgccgtctctgtcccaatctcacctctgttaactccggaagacacacaaaccgtagaaaagttccattca  7029900
                                         ------>NtERF2
                                        --------->ANAC58
                                        --------->ANAC58
                                        --------->ANAC46
       --------->ZAT18                  --------->bZIP60(1)
  ---------->DOF2                       <---------bZIP60(1)
<---------YAB1                        ------->GAMYB
--------ICU4                         --------->MYB46(3)
-------ATHB12                      --------->MYB52(1)
-------YAB5                  --------->ANAC58
---->WOX13(1)                --------->ANAC58
------->YAB1                 --------->ANAC46                                                  -----
------->YAB5               ---------->DOF2                                                     <----
---ATHB12                 <---------REM1(2)                    --------->ZAT6        <---------GLK1(1)
 
atcatcaaagaccactatcgcaaaaaccctacaagccccaacgacgccatcttaaaccctagcttaactctccatgctctctccctcgatttctcccaaa  7030000
                                                                   --------->GLK1(1)
                                                                  --------->ARR11(2)
                                                                  <---------GLK1(2)
                                                               --------->ANAC46
                                                               --------->ANAC58
                                                               --------->ANAC55(2)
                                                               <---------ANAC55(2)
                                                             <---------ALFIN1
                                   ----------->HVH21         --------->DEAR3(1)
                                 <---------ANAC58          ------>NtERF2
                                 --------->ANAC55(2)       <------NtERF2
                                 <---------ANAC55(1)      --------->ANAC58
                                 <---------ANAC55(2)      --------->ANAC46
                                 <---------ANAC58        --------->ZAT18
                                 <---------ANAC46        --------->SPL7(1)
                                <-------TEIL           <---------ARR14(2)
                             --------->At4g35610       <-----------HVH21
                             <---------At4g35610       --------->ARR14(2)<---------DOF5.7(1)      <-
                           --------->SPL7(1)      <------NtERF2--------->ANAC55(1)            ------
         --------->O2    <---------SPL7(1)      <---------RAP2.6(2)<---------GLK1(1)          <-----
 <---------HSFC1(2)      <-----------HVH21     --------->ZAT18 --------->ANAC58              <------
 --------->HSFC1(2)     --------->ETT(2)       <---------LBD16<---------LBD16             <---------
---->WOX13(2)           <---------ETT(2)      --------->ALFIN1------>NtERF2      ------>MYB83<------
-----WOX13(2)         <-----------HVH21     --------->KAN1--------->ANAC58       ------>MYB46(1)  --
 
ttgaaacttcccaagtctctccctccgtcgtccgatgcgtgatagagaagtgcggcagtgtccgccacggaatccctcttcaccaatctctagctttctt  7030100
<- Previous    Next ->

AGI:  At1g20290.1   
Description:  similar to metal ion binding [Arabidopsis thaliana] (TAIR:AT1G20240.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61991.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN69118.1); contains domain UNCHARACTERIZED (PTHR13711:SF8); contains domain SWI/SNF-RELATED CHROMATIN BINDING PROTEIN (PTHR13711)
Range:  from: 7025538    to: 7029688    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g20300.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT1G77360.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61968.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN77908.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 7029619    to: 7031525    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version