AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         <---------HSFC1(2)
                                                         --------->HSFC1(2)
                                                         --------->HSFB2a(1)
                                                         <---------HSFB2a(1)
                                                  --------->CCA1(2)
                                                 --------->ARR14(2)
                                                 --------->ARR11(3)
                                                 --------->ARR11(1)
                                                 <---------ARR11(3)
            <----------DOF2                      <---------ARR14(2)
   <------NtERF2                                 <---------RVE1(2)                               ---
 <---------LBD16              --------->KAN1   ----------->ARR10  ----------->HVH21             <---
<---------LBD16           <---------ALFIN1   ---------->DOF2    <----------DOF2                 ----
-----DOF5.7(1)       --------->At4g35610  --------->ANAC58<---------ANAC58                      <---
-GT1   --------->KAN1<---------At4g35610  --------->ANAC58<---------ANAC58                      ----
 
tttctcggcaaaattctttttataagctcacacatcttcgatagcaagtaaagatatggatgcttctctttgacatattgtttttagtggattagtgaag  6826600
                                                                                         --------->WOX13(2)
                                                                                         <---------WOX13(2)
                                                                                         <----------
                                                                                       <---------AHL25(1)
                                                                                       <---------AHL12(1)
                                                                                       --------->AHL25(1)
                                                                                       <---------AHL20(2)
                                                                                       <---------AHL25(2)
                                                                                       <---------AHL12(3)
                                      <-----------GT1                                  --------->AHL25(2)
                                   <---------AHL12(2)                                  --------->AHL20(2)
                                   --------->AHL12(2)                                  --------->AHL25(3)
                                  <---------AHL25(3)                       <---------AHL20(2)
                                  -------->ATHB1                           <---------AHL25(3)
                                  <---------ICU4          --------->AHL20(2)           --------->AHL12(1)
                                  <---------AHL12(1)      <---------AHL25(1)           <---------AHL25(3)
                                 <---------AHL25(2)       <---------AHL20(3)           --------->AHL20(1)
                                 --------->AHL12(1)       <---------AHL25(3)          --------->AHL25(1)
                                 --------->AHL20(3)       <---------AHL12(1)          --------->AHL12(3)
                                 <---------AHL20(2)       <---------AHL20(2)          --------->AHL25(2)
                                 --------->AHL20(2)       <---------AHL25(2)          --------->AHL25(3)
                                 <---------AHL12(1)       --------->AHL25(2)          <---------AHL25(2)
                                 <---------AHL20(3)       --------->AHL12(1)          --------->AHL20(2)
                                 --------->AHL25(1)     <---------AHL12(2)--------->AHL20(2)
                                 --------->ICU4         --------->AHL12(2)<---------AHL12(3)
                                 <---------ATHB51 --------->AHL20(2)      --------->AHL12(3)
                                 --------->AHL25(3)    --------->AHL20(2) <---------AHL20(2)
        --------->ZAT6           <---------AHL25(1)    <---------AHL25(3) --------->AHL25(1)
      --------->MYB52(1)         --------->AHL25(2) <---------AHL12(2)    <---------AHL25(1)
  <------ZmHOX2a(1)             <---------WOX13(2)--------->AHL20(3)      <---------AHL25(3)
------>CCA1(2)                  --------->AHL12(2)<---------AHL12(3)      --------->AHL25(3)       <
------ARR11(3)                  <---------AHL12(2)--------->AHL25(1)      --------->AHL25(2)      --
----->GATA12         <-----------RAV1(1)--------->ZAT6--------->AHL20(2)<---------AHL12(2)<---------WOX13(1)
------GATA12------->TEIL   ----------->GT1   --------->ANAC46         --------->AHL12(1)<---------AHL25(3)
----->ARR11(3)  ------->TEIL--------->At5g28300   <---------AHL20(3)  <---------AHL12(1)--------->ATHB12
 
atttaggactaactgtatgtatttttgttggggtaaattattaactctacgaaaaaaataaaaaattgagagaaaaattaaatcaacaaattaattggct  6826700
                          <---------GATA12                  --------->LBD16
                        <---------AHL12(1)                  ----------->GT1
                        <---------AHL25(1)           <---------MYB52(1)
                        <---------AHL25(3)           <--------P                                <----
                       <---------AHL12(3)           <-------GAMYB                              <----
                       --------->AHL20(2)           --------->At5g28300                       ------
                       --------->AHL12(3)          <---------DEAR3(2)                         <-----
                       <---------AHL25(1)       --------->MYB52(1)                          <-------
                       --------->AHL25(1)       ------------>AtMYB77                      <---------MYB46(3)
                       --------->AHL25(3)      --------->DEAR3(1)                        <---------AtMYB61
                      --------->AHL12(2)      --------->MYB46(3)                         --------->ALFIN1
 --------->ZAT6<---------LBD16        --------->CCA1(2)   <---------LBD16             <---------TOE2(3)
--CBF      <----------TaMYB80 ---------->DOF2 --------->DEAR3(2)                  <----------DOF2
---------AHL20(2)--------->LBD16 --------->YAB1----------->HVH21               --------->ARR11(3)
------->YAB1  --------->MYB52(1)--------->DOF5.7(1)<---------MYB46(3)          <---------ARR11(3)
 
attaaaactactgtatataccggaaaataaatccaaagatgatatgaaaaccgacggttagtccggttaataccgaaatcaagttctttgaggtggtttg  6826800
                              ----------->RAV1(1)
                             --------->ANAC58
                             ----------->HVH21                        <------ZmHOX2a(2)
                            --------->LBD16                          <---------GATA12
                           --------->ANAC46                          <-----------ARR10
                   <------MYB46(1)                                  <------ZmHOX2a(1)
                   <------MYB83                                --------->ALFIN1
     <----------DOF2<-------GAMYB                            --------->DOF5.7(1)
  ---------->ID1   <---------MYB46(3)                     ---------->DOF2
--MYB83          <---------MYB52(1)                   <----------DOF2--------->RVE1(2)          ----
--MYB46(1)      <-------GAMYB--------->ANAC58         --------->TOE2(3)      <----------DOF2    <---
--->MYB59      <---------MYB46(3)<------------CBF     --------->TOE1(3) ---------->DOF2         ----
----AtMYB61    <-----------RAV1(1)              --------->ANAC46 <------ZmHOX2a(1)             <----
--ANAC46  <------------CBF<---------LBD16     --------->ZAT6--------->DOF5.7(1)   <<<<<<<<<MYB98<---
 
gttttgttctttcgattgctgttggttatcgcgcgacattgtttttctaacacaaaactttaaaaggaggaggatcaaagcttttgttaggggttttgga  6826900
           --------->GLK1(2)
           --------->CCA1(2)
          <---------ARR11(2)
          --------->GATA12
          <---------GATA12
          <---------ARR14(2)
         <---------HSFC1(2)
         --------->KAN1<---------KAN1                          --------->At4g35610
         <---------HSFB2a(1)                                 --------->YAB1
         --------->HSFB2a(1)                     --------->ARR14(2)
        ----------->ARR10                        <---------ARR14(2)
----->At4g35610 --------->ZAT2                   --------->ARR11(2)
------At4g35610 <---------ZAT2       --------->DAG2        --------->RVE1(2)                  <-----
----->ZAT2--------->ARR14(2)        ---------->DOF2   --------->ANAC46              <---------KAN1
-----RVE1(2)<-------TEIL ----------->TBP   ----------->GT1 --------->GLK1(2)       --------->GLK1(2)
------ZAT2--------->ARR11(1)     --------->ANAC46--------->RVE1(2)             <------ZmHOX2a(1)  --
 
gctggacaagggagattcgagctcgagtatatatacacataaagtctggtaatatccacgagaatcagaagacgagatgctaggagaatgtggaaggctt  6827000
                                                             <---------ARR14(2)
                                                             <---------GLK1(2)
                                                             --------->ARR14(2)
                                                             <---------GATA12
                                                             --------->GATA12
                                                             <---------RVE1(2)
                                                         <---------LBD16
                                                         <------NtERF2
                                                        --------->LBD16
                                                        ------>NtERF2                       --------
                                                       --------->ANAC46                     <-------
                      <---------ANAC58                <---------LBD16                       <-------
          --------->MYB52(1)                       --------->ARR14(2)      <---------At4g35610
         --------->ARR14(2)                        --------->GATA12        --------->At4g35610
         <---------ARR11(2)                        <---------GATA12---------->ID1       ---------->DOF2
-----DOF2<---------ARR14(2)                        <---------ARR14(2)      --------->ZAT2   <-------
-------->DOF2         <---------ANAC58    <---------ATHB12 --------->LBD16 <---------ZAT2 ----------
 
ttaaagacagagaaaccggtcgatttcgttccaattccttcgccaatcgattcaaatcccgccggattttgtctctccagctctctaatcgaaaagattt  6827100
                                                                      <----------DOF2
                                                                  ----------->HVH21
                                                                --------->ANAC46
                                                                <---------ANAC58
                     <---------DOF5.7(2)                        --------->ANAC55(2)
                   --------->DOF5.7(2)                          <---------ANAC58
     ------>ZmHOX2a(1)                                       --------->ARR11(2)
->ARR11(3)         <---------MYB52(1)            <---------ANAC58 <---------MYB52(1)
--GLK1(2)         <-------GAMYB           <---------At4g35610<---------ARR11(2)
--ARR11(3)      <------NtERF2 <-----------RAV1(2)<---------ANAC58--------->LBD16                  --
--RVE1(2)     --------->ARR11(2)        <-----------RAV1(2) --------->KAN1              <---------At4g35610
->ARR10       <---------ARR11(2) <---------GLK1(2)     <---------DOF5.7(1)          <----------DOF2
 
tgtttctcctcatcgtggctccgttaactcccttcaggttctctcagatgtttcttgctcttcttatccgtgacttttgttctcagtctttggctgagaa  6827200
                  <---------HSFB2a(2)
                  --------->HSFB2a(2)
                 ------>ZmHOX2a(2)
                --------->CCA1(2)
                <------ZmHOX2a(2)
               <---------ARR11(3)
               --------->ARR14(2)
               <---------GATA12
               <---------AGP1
               <---------ARR11(2)
               <---------ARR14(3)
               --------->ARR11(2)
               <---------ARR14(2)
               --------->ARR14(3)
               --------->ARR11(3)
               <---------RVE1(2)                                                  <---------ZAT6
               --------->GATA12                                               <-------GAMYB
               --------->AGP1                                                <---------MYB46(3)
           ---------->DOF2                                                --------->ZAT2
     <---------AHL12(3)                                                   <---------ZAT2  <---------At5g28300
     --------->AHL20(2)                                      ----------------->AGL3   --------->WOX13(2)
     --------->AHL20(3)                              <---------HSFB2a(2)  --------->At4g35610
     --------->AHL12(3)    --------->GATA12          --------->HSFB2a(2)  <---------At4g35610
     <---------AHL20(3)    ------->TEIL         <---------At4g35610      --------->MYB111(1)
 ==============================================================================MADS_MADS <----------
 --------------->AGL15     <---------GATA12  <---------At4g35610         --------->MYB111(2)
------->YAB5  --------->RVE1(1)              --------->At4g35610        <--------P----------->GT1
 
atcactaaaaatataaaagatctgggactgaatctagtttatgtagtttgctgcttctagagtagccatattttggtagctggttgtgttattaactgtg  6827300
                                                         --------->At4g35610
                         <---------ARR14(2)              <---------At4g35610      <------NtERF2
                         --------->ARR14(2)           --------->ZAT2             ------>NtERF2
                         --------->ARR11(3)           <---------ZAT2            <---------ALFIN1
                         <---------ARR11(3)           --------->At4g35610      <---------ABI4(2)
                         --------->ARR11(2)           <---------At4g35610     <---------ATERF1(1)
                        --------->GLK1(1)  <-----------RAV1(2)                --------->PCF5
                        --------->RVE1(1) --------->At4g35610                 <---------PCF2
                        <---------GLK1(1) <---------At4g35610                <---------ATERF1(1)
            <---------LBD16            --------->At4g35610                   <---------PCF5
          ----------->HVH21  --------->At4g35610<---------MYB46(3)           ------>NtERF2
       <---------RVE1(2)--------->KAN1 <---------At4g35610 <----------DOF2  --------->ZAT18
      --------->ATHB12 --------->ARR11(3)----------->RAV1(1)                <-----------TCP11(1)
     <-------TEIL      <---------ARR11(3)=======================RAV<---------TOE2(3)--------->YAB5
-GT1<--------P  --------->ALFIN1  <---------LBD16   <-----------RAV1(2)  --------->DOF5.7(1)       -
 
ttatcaggttgatttgacggaggggagatatctgctctctggagcagcagatggttcagctgctgtatttgatgttaagcgggccaccgattacgaggca  6827400
                                                                                       <---------ARR11(2)
                                                                                    <------MYB46(1)
                                                                                 <---------MYB52(1)
                                                                          --------->At4g35610
                                                                          ------>ZmHOX2a(1)
                                                                      <---------ARR11(3)
                                          ----------->RAV1(1)         <---------ARR14(2)
            --------->ANAC58           --------->ANAC46               --------->ARR11(2)
            --------->AtLEC2           --------->ANAC58               --------->ARR14(2)
            --------->ANAC58           --------->ANAC58               <---------ARR11(2)
      <---------WOX13(1)              --------->SPL7(1)               --------->RVE1(2)--------->ARR11(2)
     <---------WOX13(2)              <---------MYB52(1)              <---------CCA1(2)<---------GLK1(1)
     --------->WOX13(2)      <---------At5g28300                     --------->KAN1 <------MYB83 ---
-------->ZAT18              <-----------GT1                   --------->KAN1 ------>NtERF2    ------
 
agtggtctaattgccaagcacaagtgtatttttactgtccgtaagcaacatgaaaatggacataaatatgccatatcctctgccatttggtatcccattg  6827500
<- Previous    Next ->

AGI:  At1g19750.1   
Description:  transducin family protein / WD-40 repeat family protein. similar to ATCSA-1, nucleotide binding [Arabidopsis thaliana] (TAIR:AT1G27840.3); similar to ATCSA-1, nucleotide binding [Arabidopsis thaliana] (TAIR:AT1G27840.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61475.1); contains InterPro domain WD40 repeat-like (InterPro:IPR011046); contains InterPro domain WD40/YVTN repeat-like (InterPro:IPR015943); contains InterPro domain WD40 repeat (InterPro:IPR001680)
Range:  from: 6826988    to: 6830054    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version