AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                     <------ZmHOX2a(1)
                                                                    --------->ANAC46
                                                                    ----------->GT1
                                                                    --------->ANAC58
                                                                    --------->ANAC58
                                                                --------->MYB52(1)
                                                             <---------WOX13(2)
                                                             --------->AHL12(2)
                                                             <---------AHL12(2)
                                                             --------->WOX13(2)
                                                            <---------AHL25(3)
                                                            --------->YAB5
                                                            <---------ICU4
                                                           --------->AHL25(1)
                                                           <---------AHL12(3)
                                                           --------->ICU4
                                                           --------->AHL12(3)
                                                           --------->AHL12(1)
                                        <---------TGA1a    --------->AHL20(2)
                                        ================================================bZIP_DOF
                                        --------->TGA1a    <---------AHL12(1)
                                        --------->O2       <---------AHL20(2)
                              --------->ANAC46             <---------AHL25(1)              <--------
                              --------->ANAC58             <---------ATHB51                ---------
                              --------->ANAC58           --------->WOX13(2)                ---------
----------->GT1             --------->ZAT6               <---------WOX13(2)               <---------KAN1
------DOF5.7(1)           <-----------GT1   <---------KAN1 --------->AHL25(3) --------->DAG2
-------DOF2      <---------WOX13(2)     <---------O2     --------->AHL12(2)   --------->DOF5.7(1)
------DAG2      <-----------GT1     --------->YAB5     --------->AHL20(2)    ---------->DOF2  <-----
-----GT1      <---------MYB52(1)   ----------->HVH21 --------->TOE2(3)       --------->DOF5.7(1)
 
tttttgttaaaaaaactgttaactatttgttacactcaatgacacgagtgaataaaacttaaataattaacaggaaacaaaaaagcgtagggaatttatc  6778600
                                               <---------AHL12(3)
                                               --------->AHL12(3)
                                               --------->AHL25(2)
                                               --------->AHL20(2)
                                   <---------AHL20(1)
                                   --------->AHL20(1)
                                   --------->AHL12(1)
                                   --------->AHL20(2)
                                   <---------AHL12(1)
                                   <---------AHL20(2)
                                   <---------AHL25(3)
                                   <---------AHL25(2)
                                   --------->AHL25(3)
                                   --------->AHL25(2)
                                   <---------AHL20(3)
                                   --------->AHL25(1)
                                   <---------AHL25(1)
                                  <---------AHL20(2)
                                  --------->AHL12(3)
                                  <---------AHL12(3)
                                  --------->AHL20(2)
                                  --------->AHL12(1)
                                  <---------AHL25(1)
                                  --------->AHL25(3)
                                  <---------AHL12(1)
                                  --------->AHL25(1)
                              --------->AHL25(3)
                              <---------AHL25(3)
                              <---------AHL25(2)
                              --------->AHL20(3)
                              --------->AHL25(2)
                              <---------AHL20(2)
                              --------->AHL20(1)
                              <---------AHL12(3)        --------->YAB1
                              <---------AHL20(3)       <---------YAB5
                              <---------AHL25(1)       <---------YAB1
                              --------->AHL25(1)     <-----------GT1
                              --------->AHL20(2)    <---------AHL20(2)
                           --------->WOX13(2)  --------->AHL20(1)
                           <---------WOX13(2)  <---------AHL20(1)
                         --------->AHL20(2)    <---------AHL20(2)
                     <---------AHL20(3)        <---------AHL25(1)
                     --------->AHL20(3)        --------->AHL25(1)
                     <---------AHL25(2)        <---------AHL25(2)
                     --------->AHL25(2)        <---------AHL25(3)
                     <---------AHL12(1)        --------->AHL25(3)
                    --------->AHL12(2)        <---------AHL20(3)
                   --------->AHL20(3)         <---------AHL25(1)
                   <---------AHL20(3)         --------->AHL25(3)
       <-----------GT1   <---------AHL20(2)   <---------AHL25(2)
      <---------YAB1<---------AHL12(2)        <---------AHL12(3)
    <---------ICU4 <---------AHL25(2)         --------->AHL20(3)
   <---------MYB52(1)--------->AHL12(1)       --------->AHL20(2)
 ----------->GT1   <---------AHL20(2)         <---------AHL20(2)
-AHL20(2)          <---------AHL12(3)         --------->AHL12(3)
>AHL25(1)          --------->AHL12(3)       --------->WOX13(2)
>AHL12(1)          <---------AHL25(1)       <---------WOX13(2)                                    --
----At4g35610     --------->AHL20(2)    --------->TOE2(3) --------->KAN1     --------->ICU4---------
 
tgatcagttattactgacctataaaattttaaataaaataaattcttaattttattttatcatatgctgtacaaaatgcaatgtttgatgcacaaaatgc  6778700
                                                    <-------TEIL
                                                <---------TOE2(3)
                                                <---------YAB1
                                            --------->WOX13(2)
        --------->ANAC55(2)                 <---------WOX13(2)
        <---------ANAC55(2)                 <---------AHL12(2)
      <-----------GT1                     --------->AHL20(2)
    <---------WOX13(2)                    --------->AHL25(3)
    --------->WOX13(2)                    <---------AHL20(2)
   <---------AHL12(2)                     <---------AHL25(1)
   --------->AHL12(2)                     --------->AHL25(1)
  --------->AHL20(2)                    --------->WOX13(2)
  <---------AHL20(2)     <---------ZAT18<---------WOX13(2)     --------->YAB1                 ------
--------->GT1       <---------RVE1(2) <---------YAB1<---------YAB5         <---------YAB1 --------->KAN1
->DOF2--------->AHL20(2)<-----------GT1 --------->TOE2(3) <---------AHL12(2)    <-----------GT1-----
 
gatgttaaattacttaatacgttgattttgcacttctcattttcattaattaagattcattttttatcaaaaaaaactactattaactatttgttatcct  6778800
                                                                       --------->ATHB12
                                                                       --------->ATHB51
                                                        <---------AHL20(2)
                                                        <---------AHL12(3)
                                                        <---------AHL25(3)
                                                        --------->AHL20(2)
                                                        --------->AHL25(1)
                                                        <---------AHL25(1)
                                                       --------->AHL20(2)
                                                       --------->AHL20(1)
                                                       <---------AHL20(1)
                                                       <---------AHL20(2)
                                                       <---------AHL25(1)
                                                       --------->AHL20(3)
                                                       <---------AHL25(3)          <---------AHL20(2)
                                                       --------->AHL25(3)          --------->AHL12(3)
                                                       --------->AHL25(2)          <---------AHL25(2)
                                --------->ANAC58       --------->AHL25(1)          <---------AHL25(1)
                                --------->ANAC58       <---------AHL25(2)          <---------AHL20(3)
         --------->YAB5  --------->TOE2(3)             --------->AHL12(1)          --------->AHL20(3)
        <---------KAN1  --------->YAB5                 <---------AHL12(1)          <---------AHL12(3)
    --------->ANAC58    --------->YAB1          ---------->DOF2       --------->ICU4
    --------->ANAC58    <---------ICU4       <---------ANAC58         <---------YAB1               <
<------ZmHOX2a(1)       --------->ATHB12     <---------ANAC46         <---------YAB5            <---
--->TOE2(3)            <---------ATHB12      <---------ANAC58      <---------MYB52(1)     <---------RVE1(2)
->ZmHOX2a(1)     --------->TOE2(3)           ----------->GT1     ----------->GT1  --------->AHL20(2)
 
caaggacacgaatgaataaaacttaaatcattaacaagaaaacagatagcgtaaagaatttatttgatcagttattattgacctataaaatttgatttga  6778900
                                                                              *TSS
                       ------------>CBF                                       ----------->TBP
                     --------->RVE1(2)                                ------>NtERF2
              <---------ANAC46                                        --------->LBD16
              <---------ANAC55(2)                                    ------->GAMYB
              ----------->GT1                                       <---------MYB55(2)
              <---------ANAC58                                      --------->MYB46(3)
          <---------HSFC1(2)       --------->YAB1          <---------ANAC58 ----------->TBP
         --------->MYB52(2)<---------ATHB12             <----------DOF2     <---------KAN1
         --------->MYB111(1) <-----------GT1           <---------ANAC58 <---------ANAC46
         ----------->ARR10--------->WOX13(2)  --------->KAN1     <---------ALFIN1     --------->TOE2(2)
        <--------P  --------->CCA1(1)        <---------YAB1<---------ANAC58<---------ARR11(2)  -----
---------TOE2(3)    --------->RVE1(1)<---------YAB5    <---------ANAC58<------NtERF2  --------->TOE1(2)
------WOX13(1)<---------ANAC58     <---------ICU4   ------>ZmHOX2a(1)--------->ANAC46----------->RAV1(2)
 
tttatgtaagggtagtttcgtaaatatccaataaaccatcatcatcttcttattcctggctttcgtctccacccgccgtatatataaaacctgagacgaa  6779000
                                                                                     <---------ANAC58
                                                                                   ------>NtERF2
                                       --------->ZAT14                       <---------At4g35610
                  --------->ANAC58     <---------ZAT14                       <---------ZAT2  -------
                  --------->ANAC58    ----------->RAV1(1)                    --------->ZAT2  -------
               --------->WRKY18(1)   --------->ANAC46                        --------->At4g35610----
-->TEIL<---------KAN4(2)           --------->ANAC46                        <--------P<---------ANAC58
 
gcttgatgagaacaatcgggcaaggccttatagagattacacaacacagatagattacacactgagaaacagagaatggtagctgaggccttgcccaaat  6779100
                                   <-----------ARR10
                                  <---------ZAT2
                                  <---------At4g35610
                                  --------->ZAT2
                                  --------->At4g35610                  --------->KAN1              <
                                <---------ALFIN1                     <----------DOF2               -
                               --------->LBD16                   <------MYB46(1)                  --
                              --------->ANAC58               <---------MYB46(3)               ------
    --------->At4g35610       --------->ANAC58               --------->ATHB12             ----------
    <---------At4g35610       --------->ANAC46              <---------YAB1               <----------
 ---------->DOF2             <---------LBD16             ============================HOX2a_HOX2a<---
----------->HVH21            ------->GAMYB       <-----------HVH21  <---------DOF5.7(1) --------->LBD16
--->DOF2                   -------->P<---------DOF5.7(1) ------>ZmHOX2a(1)             --------->LBD16
-->KAN1 <---------ALFIN1   ------>MYB83       <---------DOF5.7(2)<------MYB83 <------ZmHOX2a(2)<----
----->ZAT18                ------>MYB46(1)  --------->DOF5.7(2)<---------WOX13(1)     <---------LBD16
 
gccctgaagctccactcgtacttggactccaacccgcagctcttatcgataacgtcgctcctgttgattggtctttactcgatcaaattcccggtgatcg  6779200
 --------->ATERF1(1)
 <------NtERF2
<---------ATERF1(1)
------>NtERF2  --------->ANAC58
--------->ABI4(2)
<---------MYB46(3)
---------DEAR3(1)
-------->ALFIN1--------->ANAC58               <---------ANAC58               <-----------RAV1(1)
------->At5g28300                             <---------ANAC46              <---------RVE1(2)
>ZmHOX2a(2)  <---------MYB52(1)               <---------ANAC58        <---------DOF5.7(1)  ---------
->HVH21     <---------RAP2.6(3)           <---------WOX13(2)         <XXXXXXXXXXXXXXXXXXXXXMIR833-3P
-HVH21      <---------SPL7(1)            --------->MYB52(2)    --------->ARR11(3)      --------->ANAC58
------DEAR3(1)--------->SPL7(1)        <---------MYB52(1)   <---------WOX13(2)         --------->ANAC58
-----LBD16 <---------ANAC46          <---------ZAT6         --------->WOX13(2) --------->ALFIN1    <
 
cggtggctccattgccgtaagccattcttctctgtttttagcgttatttgagtgttttcagtgaattatctcgttttttgatgtgggtttaagcaaaagt  6779300
                                                           <---------YAB1
                                                           <---------YAB5
                                                      <----------DOF2
                                                     <---------DOF5.7(1)
                                                     ------>ZmHOX2a(2)
                                                     ===============================HOX2a_HOX2a
                                                    <------ZmHOX2a(2)
                                                    <---------RVE1(1)
                                                    ================================HOX2a_HOX2a
                                                   <---------ARR11(1)
                                                   --------->ARR14(2)
                                                   <---------ARR11(3)
                                                   --------->ARR11(3)
                                                   <---------ARR14(2)
                         --------->GATA12          <---------AGP1                           <-------PIF5
                         <---------RVE1(2)         <---------ARR11(2)                       <-------MYC2
                         <---------ARR14(2)        <---------RVE1(2)                        ------->MYC3
                         --------->ARR14(2)        --------->ARR11(2)                       <-------MYC3
                    <---------KAN1                 <-----------ARR10                        <-------MYC4
                   --------->GATA12                <---------GATA12                         ------->PIF4
                   <---------GATA12                --------->GATA12                         <-------PIF4
                   <---------ARR14(2)             <---------CCA1(2)                         ------->MYC2
                   --------->GLK1(2)              <------NtERF2                             ------->PIF5
             --------->ARR11(2)                 <---------ANAC58                           ---------
------->TEIL <---------ARR11(2)                 <---------ANAC58             <------ZmHOX2a(1)
--------->GATA12   --------->ARR14(2)           <---------ANAC46           --------->DOF5.7(1)    --
->DOF2 <----------DOF2   <---------GATA12      <---------LBD16           ---------->DOF2<---------ZAT18
---------CCA1(2)  <---------GLK1(2)<---------YAB1 <---------ARR14(1)  <-------TEIL   ---------->DOF2
 
ttgaatcttcctttggtatcggaatctggatttgaattgttattgtacttggcggatcttttgtgattctaggtgcaaaaggatgagttagagcacatgc  6779400
                                                                                              ------
                                                                                             <------
                                                                                             -------
                                                                                           <------MYB83
                                                                                           <--------
                                                                                           <------MYB46(1)
                                                                                          --------->MYB52(2)
                                                                                          <---------DEAR3(1)
                                                                                         <-------TEIL
                                                                                      <---------ANAC58
                                                                                      <------MYB46(1)
                                                                                      <---------ANAC58
                                                                                      <------MYB83
                                                                                     <---------MYB46(3)
                                            <---------ANAC58                        <---------ANAC46
                                  <---------TOE2(3)                              <-----------RAV1(1)
                                --------->AHL20(2)                               <---------ZAT6
                --------->RVE1(2)---------->DOF2        ----------->HVH21        --------->ALFIN1
  --------->ARR11(3)   --------->ALFIN1     <---------ANAC58                   <---------ANAC58
  <---------ARR11(3) <-----------RAV1(1)    <---------ANAC46                   <---------ANAC58
--------->DOF5.7(1)  --------->ALFIN1 --------->DOF5.7(1)                      <---------ANAC46   --
>KAN1       ------->TEIL      --------->WOX13(2)      --------->ALFIN1     <---------ANAC58<--------
-------->DOF2  --------->KAN1 <---------WOX13(2)  <------ZmHOX2a(1)        <---------ANAC58<--------
 
taaaagagcttgatgcacatatcagtgtggctccattaaagaagatggctggaggaagtgtgaccaatacagttcgaggcttgagtgttgggttcggtgt  6779500
<- Previous    Next ->

AGI:  At1g19600.1   
Description:  pfkB-type carbohydrate kinase family protein. similar to pfkB-type carbohydrate kinase family protein [Arabidopsis thaliana] (TAIR:AT4G27600.1); similar to unknown [Populus trichocarpa] (GB:ABK95067.1); contains InterPro domain Carbohydrate/purine kinase (InterPro:IPR011611)
Range:  from: 6778979    to: 6781164    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version