AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
-------->RVE1(2) <---------ARR11(2)        ----------->GT1      <---------ANAC46
-------->GATA12 <---------GLK1(2)------->TEIL   --------->DOF5.7(1)             --------->ANAC46
---------ARR11(2)--------->GLK1(2)     <---------YAB1        <--------P         --------->ANAC58
-------->ARR11(2)--------->RVE1(2)<---------At4g35610<-----------HVH21          --------->ANAC58
-------->ARR14(2)<---------ARR14(2)    ------>ZmHOX2a(1) <---------ANAC46     ------>ZmHOX2a(1)
---------ARR14(2)--------->ARR14(2)  ----------->RAV1(2)<---------LBD16   --------->ARR14(2)
---bZIP60(1) <------ZmHOX2a(1)<---------REM1(1)--------->DOF5.7(1)        <---------ARR14(2)  ------
cgaatccattgtataaggagaatctgtattctcatgtagctcctgatagtaaaacgggtctcgggttactggtaccagttcctaagcaagttgaagtcaa  6362800
                                                                          <---------AtLEC2 ---------
                                           <----------DOF2                --------->YAB1   <--------
                                           <---------DOF5.7(1)    --------->ARR11(2)     <---------YAB5
                                          <---------DOF5.7(1)     <---------ARR11(2)--------->TOE1(3)
                                          <---------DAG2          <---------GLK1(2)<---------ATHB12
                 --------->KAN1    <---------WOX13(1)             --------->ARR14(2)--------->TOE2(3)
                <---------RVE1(2)--------->ATHB12                 <---------ARR14(2)--------->YAB1
       <---------DAG2            --------->YAB5                <---------ANAC46 --------->AtMYB61
       <----------DOF2          <---------YAB1  <---------AtLEC2 <------NtERF2  --------->MYB46(3)
---->DOF2   <-------GAMYB     <---------At4g35610             <---------LBD16<---------WRKY18(1)
agcttgaagacttttcgttgatactctctgtttagatgattgatgccttttgcaagtctagcattggcggattcttagcatgaccaaccataaacatctt  6362900
                          <---------AHL20(2)                                 --------->AHL20(1)
                          ---------->DOF2                                    --------->AHL20(3)
                       --------->TOE2(3)        ------------>CBF             --------->AHL25(1)
        <------------CBF<---------YAB1  <---------YAB1                       --------->AHL25(2)
     <---------KAN1   <--------HAHB4    <---------YAB5                       --------->AHL20(2)
 <---------ANAC46     --------->YAB5    --------->ICU4                       <---------AHL25(2)   <-
---------->ID1        --------->YAB1   <---------TOE2(3)                ------------>CBF  <---------ARR11(3)
>ARR11(3)            <---------YAB1 --------->ARR11(3)              <---------YAB1        --------->ARR11(3)
-ARR11(3)            <---------YAB5 <---------RVE1(2)         <---------ICU4 --------->AHL25(3)<----
cttggcgcataaattgtagtttttatcattaaaacgatagataatgtttgtagcaatatggaacattatttcttattcaatataattgttcaaggtctct  6363000
            --------->KAN1                                                      <---------AHL25(3)
       ------>ZmHOX2a(2)                      --------->ALFIN1                 --------->AHL20(3)
      <---------At4g35610                   <---------ANAC46                   <---------AHL25(1)
     <---------RVE1(2)                      <---------ANAC58     --------->YAB5<---------AHL20(3)
     --------->GATA12                       <---------ANAC58    <---------ATHB12<---------AHL12(1)
     <---------GATA12                  --------->MYB52(1)      --------->RVE1(2)--------->AHL12(1) -
--------ARR11(3)                    --------->YAB1------------>CBF    <---------YAB1               -
-----HSFB2a(2)                      --------->TOE2(3)      <---------YAB5      --------->AHL25(1)  -
agatgtttgatctgcttattcaactccatactgaatcaaacttaatggcgtgaggcaatgtaatcaaatcactctcatagaaaaaaatctcagagagaaa  6363100
    --------->ARR11(3)                                <---------CCA1(2)
    --------->ARR14(2)                             <---------At4g35610
    <---------GLK1(2)                         --------->ANAC58
    <---------GATA12                          <---------TOE2(3)
    <---------ARR14(2)                     <---------RVE1(2)    <---------ANAC58
    <---------RVE1(2)       <---------GLK1(2) --------->ANAC58  <---------ANAC58         --------->ANAC58
----->MYB46(1)     --------->YAB5 <---------ANAC46 <---------HSFC1(2)                    --------->ANAC58
-------->MYB52(1)  --------->YAB1<---------LBD16<------ZmHOX2a(1)          <---------ANAC58
----->MYB83       ----------->HVH21--------->LBD16 --------->HSFC1(2)      <---------ANAC58
ccaaacagattttgaatttctatgacaactagcttctccgtgtttggataaggaagcttatcttatggcttctgttttgcttccattgccacaagtattt  6363200
                             --------->WRKY18(1) <---------ETT(2)
                    ----------->GT1          <------NtERF2
                    --------->RAP2.6(2)      --------->ATERF1(1)
                    <---------ANAC46         --------->RAP2.3(1)
                    --------->RAP2.3(2)     <---------ATERF1(1)
                 --------->ARR14(2)        --------->ANAC46                                 --------
                <------ZmHOX2a(1)         --------->LBD16                                   --------
                --------->ATERF1(1)       ------>NtERF2                                     <-------
              <---------TOE1(2)          <---------ALFIN1                                   <-------
             <-----------RAV1(2)         <---------ATERF1(1)                               <--------
        <---------ICU4   --------->DOF5.7(1)------>NtERF2                                  <--------
       <---------YAB1<---------RAP2.6(3) --------->ANAC46                                --------->WOX13(1)
      <---------RVE1(2)---------->DOF2  <---------LBD16                           --------->AtMYB61
     --------->YAB5<------NtERF2   <----------DOF2                               --------->MYB46(3)
gttttgtttgattatcgcaggagccgtaaagagtcaagctttccccgcgccgtctacaattccaattccatttcttctaattcaaccaatgccaatcatt  6363300
        <---------GLK1(1)                                                                      <----
   <---------LBD16 <---------ANAC46      --------->ANAC58                          <---------ZAT2 --
->YAB1  <---------KAN1  <---------ARR14(2)                                 ----------->TGA1---------
->ATHB12--------->GLK1(1)       --------->ARR11(3)                         ----------->HVH21  <-----
--ICU4 --------->GATA12 --------->ARR11(2)                             <------NtERF2     --------->SPL7(1)
-HAHB4 <---------ARR14(2)   --------->LBD16   ------>ZmHOX2a(1)      <---------DEAR3(1)<---------SPL7(1)
-YAB5--------->LBD16    <---------ARR11(2)    <----------DOF2       <---------MYB52(1) <-----------HVH21
-ATHB12--------->ARR14(2) <---------LBD16--------->ANAC58     --------->KAN1--------->YAB5 <--------
tccttcgccggatttctaacttctgtgaaaccggagacctcgacaagtcctttcgaactgtccaagaattcgttggcgatgacgagagctcgtccgatgc  6363400
------->ARR11(2)                                                           --------->ARR14(2)
--------ARR14(2)                                                           <---------GATA12
--------ARR11(2)                         <---------HSFB2a(2)               --------->RVE1(2)
-----ANAC58     <---------ARR11(3)       --------->HSFB2a(2)               <---------ARR11(2)    <--
-----ANAC58 ---------->DOF2           --------->GLK1(2)                    <---------ARR11(3)    ---
------->ARR14(2)--------->ARR11(3)  --------->HSFC1(2)                     --------->AGP1        ---
>At4g35610<---------HSFB2a(2)       <---------HSFC1(2)                     --------->ARR11(3)    ---
--TEIL   <---------TOE1(1)         --------->ANAC58    --------->ARR11(3)--------->DOF5.7(1)     <--
-At4g35610--------->HSFB2a(2)      --------->ANAC58---------->DOF2     ---------->DOF2     <--------
gtttcttcttgtccgagaagctcttgggcttctcttacaagcttctgggaagagaaaagacattgaaatgggaagaaagatccaccagctggtttctggg  6363500
        <---------TOE2(3)                               --------->ALFIN1
   --------->LBD16 <---------ANAC58              --------->ANAC58       <---------GLK1(2)
 <---------LBD16   <---------ANAC58              --------->ANAC58      --------->YAB5              -
-------ETT(2)--------->ICU4--------->ZAT14       --------->ANAC46     <---------YAB1              <-
-------->HVH21--------->YAB1            --------->YAB1  =====================RAV                  <-
------>WRKY38(1) <---------TGA2(2)      <-----------GT1 <-----------RAV1(1)     <---------MYB52(1)<-
------>ETT(2)<---------YAB5<---------ZAT14      ------->TEIL       ------>ZmHOX2a(1)             <--
-------WRKY38(1)----------->TGA1     --------->YAB1   <---------ANAC46<---------YAB5          <-----
-LBD16  <---------TOE1(3)--------------->AtSPL8 --------->ZAT18  ----------->RAV1(2)          <-----
tcgacccggttaaggaatgatgacgttctctgtactcgtattatcaccatgtacgctatgtgtggctctcctgatgattctcggtttgtgtttgatgcct  6363600
-------->LBD16                                   --------->CCA1(2)
--------ANAC58                                --------->ANAC58                                    --
--------ANAC58                                --------->ANAC58                             ---------
--------ANAC46                        <---------DOF5.7(1)                                  ---------
-------LBD16                       --------->At4g35610  <---------DAG2                     <--------
----ANAC58                         <---------At4g35610  <----------DOF2                    <--------
----ANAC58                  <-------GAMYB     --------->ANAC46               <---------ANAC46------>ZmHOX2a(2)
tgcggagtaagaatctcttccagtggaatgctgttatcagctcttactcaagaaacgagctttacgatgaagtattagagacgtttatcgagatgatctc  6363700
<- Previous    Next ->

AGI:  At1g18480.1   
Description:  calcineurin-like phosphoesterase family protein. similar to calcineurin-like phosphoesterase family protein [Arabidopsis thaliana] (TAIR:AT1G07010.1); similar to Putative [Brassica oleracea] (GB:AAW81738.1); contains InterPro domain Metallophosphoesterase; (InterPro:IPR004843)
Range:  from: 6361622    to: 6363000    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At1g18485.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT3G57430.1); similar to Putative Putative Pentatricopeptide (PPR) repeat-containing protein [Brassica oleracea] (GB:AAW81739.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO67948.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 6363165    to: 6366228    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version