AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                      <---------WOX13(2)
                                                      --------->WOX13(2)
                                                     <---------ICU4
                                      <---------SPL7(1)
                                    --------------->AtSPL8
                               <-------TEIL          --------->ATHB12
                             --------->At5g28300    <---------YAB1
                           --------->ANAC46        <---------RVE1(2)
                           --------->ANAC58       --------->YAB1
  <-----------GT1          --------->ANAC58 ------>MYB83                  --------->YAB5
-------->YAB1             <---------LBD16   ------>MYB46(1)             --------->RVE1(2)
--------YAB1             <-----------GT1  <---------MYB111(1)       --------->YAB1              <---
--TOE2(3)              --------->ARR11(3) <---------MYB46(2)      --------->AtLEC2         ---------
>MYB52(1)        ----------->GT1--------->KAN1   <---------YAB1<---------YAB1              <--------
---GT1 <----------DOF2 --------->RVE1(2)  <---------MYB59    <-----------GT1             <----------DOF2
 
ttttataacgcttttgtaatttgtaatatcacggtacatgctgtaccaaactttgataattgagttaccattcaaaatcactaaaacaaactctttaaat  6315200
                  <---------------------WRI1
                 --------->AtLEC2
               ---------->DOF2
              <---------ICU4
             <---------YAB1
            --------->TOE2(3)
           --------->YAB1
           <--------HAHB4
           --------->YAB5
           <---------ICU4                                                 --------->CCA1(2)
           --------->ATHB12                                            --------->ANAC58
          <---------YAB1                                               <---------YAB1             --
    --------->RVE1(2)                                                  --------->ANAC58           <-
    <---------GATA12                                                   --------->ANAC46          <--
 --------->AHL20(2)                                                  <-----------GT1             ---
 --------->AHL12(3)                                               <---------ICU4               <----
 <---------AHL20(2)                    <----------DOF2           <---------YAB5               ------
 --------->AHL20(3)               --------->MYB52(1)             --------->ICU4              <------
 <---------AHL25(1)               <-----------GT1  <----------DOF2--------->YAB1      --------->MYB46(3)
 --------->AHL25(1)      --------->TOE2(3)        <---------DOF5.7(1)--------->YAB1   <------------MYB.PH3(2)
----TEIL  <---------YAB5 --------->TOE1(3)--------->YAB1        --------->WOX13(2)    <---------MYB52(2)
>AHL20(2) <---------ATHB12   ---------->DOF2 <-----------GT1    <---------WOX13(2)--------->At5g28300
-AHL20(2) --------->ICU4----------->GT1<---------DOF5.7(1)  ----------->GT1      ----------->GT1<---
 
gcatataaatctaatcattaatgcaaaacgttaaaagtaacgcttttataacgcctttgtaatttgtaattatcacgatacaggctgtaacaaactttga  6315300
                                                          --------->ATHB51
                                                          --------->ATHB12
                                                          <---------ICU4
                                                         <---------YAB5
                                                         --------->ICU4
                                                         <---------YAB1
                                                       --------->YAB1
                                                       --------->YAB5
                                                       <--------HAHB4
                                                       <---------ICU4
                                                      <---------ATHB12
                                                --------->RVE1(2)
                                             --------->AHL25(1)
                                             --------->AHL20(2)
                                             <---------AHL20(3)
     <-----------GT1                         --------->AHL20(3)
------->WOX13(2)                             <---------AHL20(2)
--------WOX13(2)                             <---------AHL12(3)<---------ANAC46
-------ICU4                                  --------->AHL12(3)<---------ANAC58               ------
------>ATHB12     --------->YAB5             <---------AHL25(1)<---------ANAC58        --------->ANAC58
-----RVE1(2)    --------->RVE1(2)         ------->TEIL--------->ICU4               --------->ANAC46<
--->YAB1    --------->YAB1         <---------AHL20(2) <---------YAB1      --------->TOE2(3)   ------
---YAB1<---------YAB1              --------->AHL20(2) <---------YAB5--------->GATA12   --------->ANAC46
------YAB1--------->AtLEC2       <----------DOF2<---------GATA12    <---------GATA12   --------->ANAC58
 
taattgagttaccattcaaaatcactaaaacaaactctttaaatgtatataaatctaatcattattgcgtagatttatctcaatatacacaagccactat  6315400
                 <------ZmHOX2a(1)
           --------->MYB111(1)
       --------->LBD16
      <---------LBD16                                                                          <----
      <---------ANAC58                                                                        ------
      <---------ANAC58                                                                       <------
      <---------ANAC46                                                              --------------->AGL15
      <---------ANAC55(1)                                                           <---------------AGL15
     <---------LBD16                                                               <----------------
   <---------ARR14(2)                                                <---------ETT(2)  <---------DOF5.7(1)
   --------->ARR11(2)                                                --------->ETT(2) --------->ICU4
   <---------ARR11(2)                                  --------->CCA1(2)           -----------------
   --------->ARR14(2)                          ------->PIF5    --------->MYB52(1)  =================
--->ZAT14 <--------P                           <-------PIF5--------->YAB1          -----------------
-----------RAV1(2)                       <-----------GT1  <---------YAB5           -----------------
---->DOF2 <---------KAN1             ------->TEIL     <---------ARR11(3)           <----------------
 
agccaggttccgggtaagtaggacagatagcagtcccatgcatttaacctcgtgcaagataaacataaacggtagacacactagttgccatttttagata  6315500
                     ---------->DOF2
                 <---------YAB1
                 <---------TOE2(3)
             --------->WOX13(2)
             <---------WOX13(2)
             <---------AHL12(2)
            <--------ATHB1
            <---------AHL25(3)
            --------->YAB5
            -------->HAHB4
            <--------HAHB4
            --------->ATHB51
            <---------ICU4
            --------->YAB1
           <---------AHL12(1)
           --------->ICU4
           <---------ATHB51
           --------->AHL25(3)
           --------->AHL20(2)                   <---------AHL20(2)
          <---------AHL12(2)                 --------------->AGL15        <---------ATERF1(1)
          --------->AHL12(2)                 <---------------AGL15 <---------ANAC58
          --------->AHL12(3)               <---------TOE2(3)  --------->WOX13(2)
          --------->AHL20(3)              <-----------GT1    --------->KAN1
    --------->MYB46(3)<---------------AtSPL8<-----------------AGL3 <---------ANAC58
---TEIL   <---------AHL20(3)            <---------WOX13(1)   --------->ATHB12
--->CCA1(2)<---------YAB1             --------->YAB5        --------->AHL25(3)                 <----
---RVE1(2)<---------AHL25(2)         <---------YAB5         --------->AHL12(1)                ------
-AGL3     --------->AHL25(2)       ----------->GT1          --------->AHL20(2)          <---------GATA12
>AGL1     <---------AHL12(3)     --------->DOF5.7(1)        <---------AHL12(1)          --------->GATA12
==============================================================MADS_MADS  <---------TOE1(2)    ------
>AGL3    <---------AHL25(3)    --------->DOF5.7(1)        <---------ARR11(3)    ------>ZmHOX2a(1)
>AGL2    --------->YAB1 <----------ID1--------->ATHB12    --------->ARR11(3)--------->ARR14(2)------
-AGL2   --------->AHL20(2)     ---------->DOF2 --------->AHL20(2) --------->At4g35610 ---------->DOF2
 
caactcaacaaataataattaagataaagaacaaaaaagagtgattaacatttaatggaaagatttattagcttcccaggctcctcacttaaatcccact  6315600
                                                                                                 <--
                                                                                                <---
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                              ------
                                                                                            --------
                                                                                          ----------
        ----------->TBP                                                                   <---------DOF5.7(2)
       --------->RVE1(2)                                                                 <---------ARR11(2)
-----ATHB12                                 --------->YAB1                               <---------ARR14(2)
--->ANAC58                                  <---------ICU4                               --------->ARR14(2)
--->ANAC46                                 *TSS                                   --------->KAN1----
--->ANAC58                           <------ZmHOX2a(2)                   <---------AtLEC2--------->ARR11(2)
 
caagtctccatataaaaactgcaacttccatcactcttcgatcaccatcatcactctctctctctctcttctatttccatggctcttgttcgtaaacgcc  6315700
                                                                            <-----------TGA1
                                                                            <-----------HVH21
                                                                           --------->ANAC46
                                                                           --------->bZIP60(2)
                                                                          <------NtERF2
                                                                         ------>NtERF2
                                                                        --------->RAP2.3(3)
                                                                        --------->DEAR3(1)
                                                                       --------->ATERF1(1)
       --------->TOE2(2)                                              --------->ABI4(1)
       ------->GAMYB                                                  <---------ATERF1(1)
      --------->MYB46(3)                                             --------->AtMYB61           <--
     -------->P                                                      --------->DREB2C(2)         ---
  <---------ATHB12                                                   --------->DEAR3(1)          ---
 --------->RVE1(2)                                                   ------->GAMYB               <--
----NtERF2                                ------>MYB46(1)            <---------ALFIN1      <--------
--------HVH21                           --------->AtMYB61           --------->ANAC46      <---------GLK1(2)
---->DEAR3(1)                           <---------ALFIN1            --------->MYB46(3)    --------->ARR14(2)
---->RAP2.3(2)             --------->ZAT14------>MYB83              --------->DEAR3(2)    --------->ARR11(2)
---->RAP2.3(3)            --------->DEAR3(1)           <----------DOF2------>NtERF2     ------->GAMYB
---->RAP2.6(2)           --------->MYB46(3) ----------->RAV1(2)     --------->ORA47(2) --------->ANAC58
--->RAP2.3(1)          <---------ALFIN1 --------->DEAR3(1)         <---------At5g28300 --------->ANAC58
->ANAC46            --------->PCF2     --------->At4g35610        <---------ALFIN1   --------->MYB52(1)
>DOF2------->TEIL  <-----------HVH21   <---------At4g35610       --------->MYB46(3) --------->MYB46(3)
-->NtERF2       ----------->RAV1(2)  <-----------GT1  <---------DOF5.7(1)<---------ATERF1(1)<-------
 
gtcaaatcaacctccgtctccctgtcccaccgctctctgttcacctcccctggttctcctttgcctcatccaccgcccccgtcatcaacaacggaatctc  6315800
                                                                                    <-----------GT1
                                                                                    --------->KAN1
                                                                                   <---------ARR14(2)
                                                                                   --------->ARR14(2)
                                                  <---------ARR11(2)               --------->ARR11(2)
                                               ------>ZmHOX2a(2)                  --------->CCA1(2)
                                             <---------GATA12                    <---------ARR11(3)
                         <---------LBD16     --------->GATA12                    --------->ARR11(3)
                         --------->HSFB2a(2) <---------ARR14(2)          <---------O2
                     ------->MYC2       <---------LBD16        ----------->RAV1(1)--------->KAN1
                     <-------MYC3       --------->At4g35610   --------->ANAC46 ----------->ARR10
         --------->HSFB2a(2)         --------->At4g35610     ----------->RAV1(1) <---------RVE1(2)
-------At4g35610     <-------MYC2    <---------ZAT2        <---------ZAT18<-------PIF5
------>ZAT2          ------->MYC3    <---------At4g35610   --------->ZAT18------->PIF5
------>At4g35610  <---------ALFIN1<------ZmHOX2a(1)   ---------->DOF2    --------->O2 --------->ANAC46
-------ZAT2  --------->KAN1       ====================HOX2a_HOX2a--------->ANAC46<---------ARR14(2)
---ARR10 <---------HSFB2a(2)  --------->DOF5.7(1) --------->ARR11(2)    <---------LBD16           --
--KAN1  <---------ETT(2) <---------HSFB2a(2) --------->ARR14(2)--------->AtMYB61 --------->ARR14(2)<
 
agcttccgatgtcgagaaactccacgttctcggaagaggaagcagcgggatcgtatacaaagtccaccacaaaaccacgggggagatatacgctctgaaa  6315900
                                                                                                   -
                                                                                                   <
                                                                     <---------ARR11(2)           --
                                                                  --------->ANAC58                <-
                                                                  --------->ANAC58                --
                                                                 <---------LBD16                  --
                                                               <---------SPL7(1)                  <-
                                                            <-----------HVH21             <---------
                                                      <------ZmHOX2a(2)                <---------At4g35610
                                                      =============================HOX2a_HOX2a    <-
                                                     <---------ARR11(2)              <-----------RAV1(2)
                                                     ----------------------->TaNAC69(2)--------->O2<
                                                     <---------RVE1(2)              <---------MYB52(1)
                                                     <---------GATA12--------->ARR11(2)<---------O2<
                                                     --------->ARR11(2)            <-----------HVH21
          <---------O2                               <---------ARR14(3)            <-----------TGA1<
          --------->O2                               <---------ARR14(2)           <---------ETT(2)--
         <------NtERF2                               --------->ARR11(3)           <---------bZIP60(1)
        ----------->RAV1(1)                          <---------ARR11(3)           --------->ETT(2)<-
        ------>NtERF2                                --------->ARR14(3)           --------->TGA2(1)-
     ------->GAMYB                                   --------->ARR14(2)           --------->bZIP60(1)
  --------->MYB52(1)                    --------->ZAT18    --------->ANAC46 ========================
  <---------DOF5.7(2)                   <---------ZAT18  ------>ZmHOX2a(1)  ========================
 <---------WRKY45                 --------->WOX13(2) --------->GATA12<---------ARR14(2)<---------TGA1a
 <---------WRKY12                 <---------WOX13(2)<---------GLK1(1)<---------RVE1(2) --------->At4g35610
 <---------WRKY38(1)         --------->ANAC58       --------->GLK1(1)--------->ARR14(2)--------->ANAC55(2)
--------->WRKY18(1)          --------->ANAC58      ----------->ARR10 <---------GLK1(2) <---------ANAC55(2)
------->WOX13(1)      <----------DOF2  <---------ANAC58============================HOX2a_HOX2a    <-
-----------HVH21   ------>ZmHOX2a(1)   <---------ANAC58------>ZmHOX2a(2)    ------>ZmHOX2a(1)     --
 
tcagtcaacggcgacatgagtcctgctttcacaagacaattagcgcgcgagatggagatcctccgtcgcacggattctccttatgtcgtcaggtgtcaag  6316000
                                                                                      <---------ANAC55(2)
                                                                                      <---------ANAC46
                                                                                     <---------LBD16
                                                                                   ----------->HVH21
                                                                                   <---------MYB52(1)
                                                                                   --------->ARR14(2)
                                                                                   <---------ARR11(2)
                                                                                --------->RAP2.3(1)
                                                                                <------NtERF2
                                                                               --------->ABI4(2)
                                                                               <---------ATERF1(1)
                                                                               ------>NtERF2
                                                                               <---------RAP2.3(1)
                                                                              --------->DEAR3(1)
                                                                              <---------DEAR3(1)
                                                                              --------->RAP2.3(2)
                                                                             <---------ABI4(2)
                                                                             --------->ATERF1(1)
                                                                             <------NtERF2
                                                                             --------->RAP2.6(1)
                                                                             --------->RRTF1(1)
    --------->HSFC1(1)                                                       --------->RAP2.3(1)
    <---------HSFB2a(2)                                                      --------->ERF1
    <---------HSFC1(1)                                                       --------->DEAR4(2)
    --------->HSFB2a(2)                                                      ------>NtERF2
------>ZmHOX2a(2)                                                           --------->DEAR3(1)
-------->KAN1                                                               ------>NtERF2
------ZmHOX2a(2)                                                            <---------DEAR4(2)
------->ARR14(2)                                                            <---------RAP2.3(1)
--------ARR11(2)                                                            <---------ORA47(2)
------->ARR11(3)                            --------->ARR14(2)              <---------ATERF1(1)
------->ARR14(3)                            <---------ARR11(2)             --------->ANAC46
--------RVE1(2)                 <------ZmHOX2a(2)                         <---------LBD16
--HVH21      ------>MYB46(1)   --------->ARR11(2)                         --------->At4g35610
--------ARR11(3)               <---------RVE1(2)                          --------->LBD16
---------HSFB2a(1)             --------->GATA12                           ------>NtERF2
---------KAN1------>MYB83      <---------ARR14(2)                         <---------At4g35610
---------HSFC1(2)              <---------GATA12                   <-----------ARR10--------->ARR11(2)
------->ARR11(2)               --------->ARR14(2)  <---------DEAR3(1)    --------->ANAC46
--------ARR14(2)          <---------ARR14(2)--------->ARR11(2)    --------->GLK1(2)<---------ARR14(2)
-------->HSFB2a(1)        <---------ARR11(2)<---------ARR14(2)   <---------GLK1(2)<-------GAMYB
=======HOX2a_HOX2a  <------NtERF2          <---------KAN1    --------->TOE1(2)--------->RRTF1(3)
======HOX2a_HOX2a <---------DEAR3(1)     <---------ANAC46<---------ARR11(2)<---------DEAR3(1)    <--
--------GATA12  <-----------HVH21  ------>ZmHOX2a(1)----------->GT1<---------KAN1 <-----------HVH21-
------->GATA12<---------ATHB12 <---------ARR11(2) <---------ORA47(1)    <---------LBD16--------->LBD16
 
ggatcttcgagaaaccaatcgtcggagaggtttcgatcctcatggagtatatggacggtggaaacctagaatctctccgcggcgccgttacggagaaaca  6316100
<- Previous    Next ->

AGI:  At1g18350.1   
Description:  ATMKK7 (MAP KINASE KINASE7); kinase. similar to ATMKK9 (Arabidopsis thaliana MAP kinase kinase 9), kinase [Arabidopsis thaliana] (TAIR:AT1G73500.1); similar to double MYC-tagged mitogen activated protein kinase kinase 7 [synthetic construct] (GB:ABF55667.2); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine protein kinase, active site; (InterPro:IPR008271); contains InterPro domain Tyrosine protein kinase; (InterPro:IPR001245)
Range:  from: 6315644    to: 6316731    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version