AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->ANAC58               <---------AHL12(2)
            --------->AHL20(2)                          <---------WOX13(2)
            --------->AHL20(1)                          --------->WOX13(2)
            <---------AHL25(1)                         <---------AHL20(3)
            <---------AHL20(2)                         <---------AHL25(3)
            <---------AHL12(1)                         --------->AHL20(3)
            --------->AHL12(1)                         <XXXXXXXXXXXXXXXXXXXXXMIR845B
            <---------AHL25(3)                         <---------AHL20(2)
            <---------AHL25(2)                         --------->AHL20(2)
            --------->AHL25(2)                        --------->AHL20(2)
           --------->AHL12(2)                     --------->ICU4
           --------->AHL25(1)                    ----------->GT1
           <---------AHL12(3)                --------->LBD16  --------->GATA12
           --------->AHL25(3)                <---------HSFB2a(2)
    ----------->GT1      --------->ANAC46    --------->HSFB2a(2)<-------TEIL
  <---------YAB5         --------->ANAC58   <---------LBD16   <---------GATA12
------>TOE1(3)       --------->ANAC58      <---------LBD16    <---------RVE1(2)              <------
------>TOE2(3)       --------->ANAC58   --------->KAN1--------->AHL25(3)               <---------WOX13(2)
--ATHB12   <---------AHL25(2)          <-------TEIL   <---------AHL20(2)               --------->WOX13(2)
>WOX13(2)  --------->AHL20(2)          <---------YAB5 --------->AHL25(1)            <---------YAB1
 
ccctaatcggtgaaaaaaattggaaggcaagcaactacaagattcatccgggaagtattaatttagattcagagcgagagagaagttatcaattggattg  5969600
                     <---------WOX13(2)
                     --------->WOX13(2)
             <-------TEIL
            <------ZmHOX2a(2)
           --------->RVE1(2)
           --------->ARR11(2)                             --------->YAB1
           --------->ARR14(2)                         --------->KAN1
           <---------ARR14(2)                         --------->KAN4(1)
           <---------ARR11(2)                        <---------KAN4(2)
           --------->GATA12 <---------ZAT14          <---------KAN1
           <---------GATA12 --------->ZAT14  --------->DAG2        <------ZmHOX2a(1)     <---------KAN1
          --------->At4g35610        --------->MYB52(1)  <---------YAB5                <---------GLK1(2)
---WOX13(1)--------->AGP1   --------->ZAT18  --------->DOF5.7(1) <---------TOE2(3) -----------------
 
aaactcaactctcagatccattgcaattgagttcacagacaaaccgataaggtcggattattcatactaaggaaaacaatagaacccctagaatttctcg  5969700
           <------NtERF2
          ----------->RAV1(1)
          ------>NtERF2
         ----------->HVH21
         <---------ETT(2)
        --------->RAP2.3(1)
       <---------ATERF1(1)
     --------->DEAR3(2)
  ----------->HVH21
<---------ZAT2
--------->ANAC55(2)                                                            --------->LBD16
--------->O2                                                               <---------WRKY18(1)
--------->ZAT2                                                            --------->WRKY12
<---------At4g35610                                                     <---------ANAC58
--------->At4g35610                                                     <---------ANAC58
<---------TGA1a                                                  <<<<<<<GRF7 <---------LBD16
======================RAV              <------ZmHOX2a(1)       ------>ZmHOX2a(1)          --------->ARR14(2)
--------->TGA1a                     <------ZmHOX2a(1)          ----------->HVH21          <---------ARR14(2)
<---------O2                      --------->ALFIN1    <---------ANAC55(2) --------->WRKY38(1)     --
----------->RAV1(2)              <------ZmHOX2a(1)    --------->ANAC55(2) ----------->HVH21       --
---->WRI1--------->DEAR3(1)     --------->DOF5.7(1)<---------RVE1(2)    >>>>>>>>>>WRKY18 --------->KAN1
 
ctcacctgaccggcgacaaggagacagaggcgagaaggaggaggaacaatatttgatatgtgattcctgacattgacttgaccggagaacacaaattcgg  5969800
                                                                                                   -
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                      <---------YAB1                                              --
                                   <---------AHL25(3)                                             --
                                   <---------AHL20(2)                                             <-
            <---------KAN1    --------->LBD16     <------ZmHOX2a(1)                              <--
  ------>MYB46(1)            --------->LBD16     ----------->GT1                                ----
  ------>MYB83             ------->GAMYB       <------NtERF2                   <------NtERF2------>ZmHOX2a(1)
  <-----------HVH21     --------->ARR11(2)  <---------LBD16                  <---------ANAC46  -----
  --------->MYB52(1)   ----------->HVH21---------->DOF2                   <-----------RAV1(1)-------
------->ANAC58  <------ZmHOX2a(1) <---------AHL20(3)                      ==========================
------->ANAC58--------->MYB59--------->ANAC46 --------->LBD16       --------->GLK1(2)      <--------
 
caacctatcagacgaattaggacgatgtaaccccgaaatttatgaaagccggaggaaaattgtgttcggagaagctaatgtcgtcgagtttgctcctcct  5969900
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                    <---------KAN1                                --
<------NtERF2                                      --------->GATA12                               <-
-------->LBD16                                     <---------GATA12                              ---
--------ATERF1(2)                                  <---------ARR11(1)                            <--
------->HSFB2a(2)                                  --------->GLK1(2)                            ----
------->LBD16                                      --------->RVE1(2)                            ----
--------ANAC46                                     --------->ARR14(2)                           ----
------->RAP2.6(2)                                  <---------ARR14(2)                           <---
------->ATERF1(2)                                  ------->TEIL           --------->ANAC58      <---
--------HSFB2a(2)                     ----------->GT1        --------->TOE2(3) --------->ICU4 <-----
-------LBD16                        --------->DOF5.7(1)   --------->YAB1---------->DOF2       ------
----->MYB52(1)                     --------->DOF5.7(1)  --------->AHL20(3)--------->ANAC58    ------
->ZmHOX2a(1)                      --------->DOF5.7(1)   <---------AHL20(3)--------->ANAC46    ------
---->RAV1(2)           <---------TOE2(3)          <---------CCA1(2)*TSS--------->YAB1         <-----
=====RAV              <---------DOF5.7(2)         <---------ARR14(1)  <---------YAB5          ------
-ALFIN1    ---------->DOF2        ---------->DOF2 <---------GLK1(2)<---------AHL20(2)         ------
 
gccggaaaactctgaaacgcgcgtttaacgtcgacttaaaagggctaaaacccgaatcttataatcttatataatcaaagccatttttgacaaaaaaaaa  5970000
          <---------AHL20(2)
          --------->AHL12(3)
          <---------AHL12(3)
          --------->AHL12(1)
          <---------AHL12(1)
         <---------AHL20(1)
         --------->AHL25(3)
         --------->AHL20(1)
        <---------AHL20(2)
        --------->AHL12(3)
        <---------AHL12(3)
      --------->AHL20(2)
      <---------AHL12(3)
      <---------AHL20(2)
      <-----------TBP
      --------->AHL12(3)
    <---------AHL20(2)
    <-----------TBP
    <---------AHL12(3)
    --------->AHL12(3)
    --------->AHL20(2)
  <-----------TBP
  <---------AHL20(2)
  --------->AHL12(3)
  --------->AHL20(2)
  <---------AHL12(3)
--------->AHL20(2)
----------->TBP
<---------AHL12(3)
--------->AHL12(3)                                          <---------WOX13(1)
---------AHL25(3)                                          <------------CBF
---------AHL20(1)                             --------->AHL20(3)
-------->AHL20(1)                             <---------AHL12(1)
------->AHL25(1)                              --------->AHL12(1)
------->AHL12(3)                              --------->AHL25(3)
--------AHL12(3)                              --------->AHL20(1)
------->AHL20(2)                              <---------AHL20(1)
------->AHL12(1)                              <---------AHL25(2)
--------AHL12(1)                              --------->AHL25(2)
------>AHL12(2)                               <---------AHL20(3)
-------AHL12(2)                              <---------AHL12(2)
----->AHL12(3)                               <---------AHL12(3)
----->AHL25(2)                               --------->AHL12(2)
----->AHL20(2)                               <---------AHL25(2)
------AHL12(3)                             --------->AHL20(2)
------AHL12(2)                             <---------AHL20(3)
----AHL12(3)                               --------->AHL12(3)
--->AHL20(3)                               --------->AHL25(2)
--->AHL25(2)                 --------->YAB1--------->AHL25(1)            <---------MYB52(1)
--->AHL25(1)                <---------ATHB12 --------->AHL25(2)  <---------ICU4
----AHL20(3)               --------->RVE1(2) --------->AHL12(3)  --------->YAB1            ---------
--->AHL12(3)    <---------TOE2(3)          --------->AHL20(3)   <---------YAB1      <----------ID1 <
--->AHL20(2)  <---------AHL20(2)           <---------AHL12(3) --------->YAB1    <---------ZAT14<----
 
aatatatatatatatatttaagtttgggcctatcaacatttttaaaaaaaatattagggcccgattgataataactgttaggctgtagagacaaacactc  5970100
              --------->AHL20(3)
              --------->AHL12(3)
              <---------AHL20(2)
              <---------AHL12(3)
              <---------AHL25(2)
            --------->AHL12(2)
            --------->AHL12(3)
            <---------AHL25(2)
            <---------AHL12(3)                                                         --------->YAB1
            <---------AHL20(2)               <---------AHL12(1)                      <---------WOX13(2)
           --------->AHL12(2)                --------->AHL12(3)             <---------AHL12(3)
           <---------AHL12(2)                <---------AHL12(3)             <---------AHL12(2)
          <---------AHL25(1)                 --------->AHL12(1)            --------->AHL12(3)
          <---------AHL12(3)                 --------->AHL25(3)            <---------AHL20(2)
          --------->AHL12(3)                 <---------AHL25(1)            --------->AHL20(1)
          <---------AHL20(2)                 --------->AHL25(1)            <---------AHL12(3)
          <---------AHL12(1)             --------->AHL20(2)                <---------AHL20(1)
          --------->AHL12(1)   <---------WOX13(2)                          --------->AHL25(3)
         <---------AHL20(1)    --------->WOX13(2)                          --------->AHL25(1)
         --------->AHL25(3)    <---------AHL12(2)                          <---------AHL12(1)
         --------->AHL20(1)   --------->AHL12(2)                           --------->AHL12(1)
        <---------AHL12(2)   --------->AHL20(2)                            <---------AHL25(3)
        --------->AHL12(2)  --------->AHL20(2)          ----------->GT1    <---------AHL25(2)
       <---------AHL20(2)   <---------AHL12(3)          <------MYB46(1)    <---------AHL25(1)
      --------->AHL20(2)    --------->AHL25(1)          <------MYB83       --------->AHL25(2)
  <---------YAB1            <---------AHL25(1)         --------->MYB46(2)  --------->AHL20(2)
  <---------AHL20(2)        --------->AHL25(3)         --------->MYB59    --------->AHL12(3)
 <---------AHL25(2)         --------->AHL12(3) <---------AHL12(2)         <---------AHL12(3)
 --------->AHL20(3)         <---------AHL20(2)<---------AHL25(3)          --------->AHL25(1)
 <---------AHL20(2)     --------->AHL12(3)   <---------AHL20(2)           --------->AHL25(3)
 <---------AHL20(3)     <---------AHL12(3)   --------->AHL20(2)           <---------AHL12(1)
 --------->AHL12(3)     --------->AHL20(3)  <---------AHL12(2)            <---------AHL25(1)
 <---------AHL12(3)     --------->AHL20(2)  --------->AHL12(2)            --------->AHL12(1)
>KAN1<---------YAB1     <---------AHL20(3) <---------AHL12(2)             <---------AHL20(2)
---------YAB1 <---------AHL25(1)   <---------YAB1  <---------YAB1         --------->AHL20(2)
-----DOF5.7(1)<---------AHL20(3) --------->KAN1<---------AHL12(3) <----------ID1----------->GT1
 
ttatttttattatatatttttttttaaaaatataaattatgctaaaaaataaatatgtttggtaatataggggcaaaataaatttgttaataagaaagtt  5970200
                <---------------AGL15
              --------->YAB1
             <-------TEIL
        <---------AHL12(3)
        --------->AHL25(3)
        <---------AHL25(1)
        --------->AHL25(1)
        <---------AHL25(3)
        --------->AHL12(3)
        <---------AHL20(2)
        --------->AHL20(2)
      <---------AHL12(2)                 --------->AHL12(1)
     <---------AHL12(2)                  --------->AHL25(1)
    <---------AHL12(1)                   --------->AHL25(2)
    --------->AHL25(2)                   <---------AHL25(1)
    --------->AHL12(1)                   <---------ICU4 ---------->DOF2
    --------->AHL12(3)                   --------->AHL12(3)                                      ---
    <---------AHL25(3)                   <---------AHL12(1)                                      <--
    <---------AHL12(3)                   --------->AHL20(2)                                     <---
   <---------AHL12(1)                    <---------AHL25(2)                                     ----
   --------->AHL12(1)                    <---------AHL12(2)                                     <---
   <---------AHL12(3)                    <---------AHL25(3)                                     ----
   --------->AHL20(2)                   <---------AHL25(1)                                      ----
   <---------AHL25(2)                   <---------AHL12(3)                                      ----
   --------->AHL25(3)                   --------->AHL12(3)                        <-------TEIL <----
   <---------AHL25(3)                   <---------AHL20(2)                       --------->CCA1(2)
   --------->AHL25(2)                   <---------AHL25(2)         <---------AHL12(1)          -----
   <---------AHL25(1)                   --------->AHL25(3)        --------->AHL20(2)          ------
   <---------AHL20(2)                   <---------AHL12(1)        <---------AHL12(2)          <-----
   --------->AHL12(3)                   --------->AHL12(1)        --------->AHL25(2)     <------MYB83
   --------->AHL25(1)                   --------->AHL20(2)        <---------AHL25(1)     <------MYB46(1)
  --------->AHL12(3)                    <---------AHL25(3)        --------->AHL12(3)     -----------
  --------->AHL25(3)                    --------->AHL25(1)----------->GT1       --------->ARR11(3)
  <---------AHL25(2)              ----------->GT1     <---------AHL25(3)        --------->ARR11(1) -
  --------->AHL25(2)            --------->ZAT14      --------->AHL20(2)--------->YAB1   --------->MYB59
  --------->AHL20(2)            <---------ZAT14 <---------At4g35610--------->AHL12(1) <---------MYB52(1)
  --------->AHL25(1) ---------->DOF2   --------->AHL12(2) <----------ID1    ---------->DOF2   <-----
 
ttcaaaaaaatttaaattcataaataaagaaatactgtagtaaataatttcagcaaataaaaagaaaaaaaaaatcatataaagatacagtttggttatt  5970300
          <---------WOX13(2)
       --------->AHL25(3)
      <---------AHL12(2)
   --------->AHL12(2)
   <---------AHL12(2)
  <---------AHL25(3)
  --------->AHL20(3)
  --------->AHL12(3)
  <---------AHL20(2)
  <---------AHL12(3)
  <---------AHL20(3)
  <---------AHL25(2)
  <---------AHL25(1)
 <---------AHL25(1)
 <---------AHL12(1)
 --------->AHL25(3)
 --------->AHL25(1)
 --------->AHL12(1)
 <---------AHL20(2)
 --------->AHL20(2)                                                                             <---
--------->AHL12(2)                                                                              ----
<---------YAB1                                                                                  <---
<---------AHL12(2)                                                                             <----
------>ICU4            <---------ARR11(3)                                                      -----
-------YAB1  <-----------GT1                                                                  <-----
------AHL20(3)         <---------RVE1(2)                            <---------------AtSPL8    <-----
----->AHL20(3)         --------->ARR11(3)                        <---------RVE1(2)           <------
------AHL25(2)    -------->P                                     <---------ARR11(3)          <------
----->AHL12(2)    ------>MYB83                                   --------->ARR11(3)          <------
----->AHL25(2)  ------->GAMYB                                    <---------ARR14(2)          -------
----->AHL12(3) --------->MYB46(3)                                --------->ARR14(2)          -------
-----ICU4 --------->WOX13(2)                               --------->ZAT14                  --------
---->YAB1 --------->AHL12(2)       --------->WOX13(2)      <---------ZAT14               ---------->DOF2
--->ICU4  <---------AHL12(2)    <---------MYB59         <---------ANAC58               <------NtERF2
----YAB5--------->AHL20(2)<---------------AtSPL8        <---------ANAC46              ------>NtERF2
>GT1  --------->AHL12(2)  <---------------AtSPL3        <---------ANAC58       <---------ARR11(2)
-------->AHL12(2) ------>MYB46(1)  <---------WOX13(2)  --------------->AtSPL3  --------->ARR11(2)
----YAB1<---------AHL20(2)--------------->AtSPL8       <---------------AtSPL8--------->YAB5---------
 
attattaatttttaattaaccaactagatattgtacttaactaaaacgtctcactgatttcgtacacagatattgtacatcgattacgctggcaaagata  5970400
  <---------WOX13(2)
  --------->WOX13(2)
------AHL12(3)
----->AHL20(3)                                                                                     -
------AHL20(3)                                                                                    --
-----AHL25(2)                                                                             <---------MYB52(1)
---->AHL25(2)                                                                            <---------RAP2.6(3)
----RVE1(1)                                                                              --------->At5g28300
----CCA1(1)                                                                             --------->RAP2.6(2)
---AHL20(1)                                                                             ----------->GT1
---ARR11(3)                                                                       --------->ALFIN1--
---RVE1(2)                                                   ----------->GT1     --------->ARR11(3)<
-->AHL20(1)                                                ---------->DOF2     <---------TOE1(3)<---
-->ARR11(3)                                     <-----------GT1            ------>ZmHOX2a(2)   <----
->YAB1                                      --------->ARR11(3)           <---------ARR11(3)  <------
-->ARR10      <----------DOF2     <---------GLK1(1)     ----------->GT1  --------->ARR11(3)  -------
 
tttttagttagaaaatgcttttatggctaaaacatggaaatgtggatgattttgccaaatggtaaagataaaacatgatcttaaggtctggccgtaaatt  5970500
<- Previous    Next ->

AGI:  At1g17410.1   
Description:  nucleoside diphosphate kinase family protein. similar to NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2), ATP binding / nucleoside diphosphate kinase [Arabidopsis thaliana] (TAIR:AT5G63310.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN77593.1); similar to Os02g0565100 [Oryza sativa (japonica cultivar-group)] (GB:NP_001047164.1); contains InterPro domain Nucleoside diphosphate kinase, core; (InterPro:IPR001564)
Range:  from: 5968566    to: 5969968    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version