AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                 ---
                                                                                                <---
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                           <------ZmHOX2a(2)
                                                                                           =========
                                                                                           ---------
                                                                                          --------->ARR14(2)
                                                                                          <---------ARR11(3)
                                                                                          <---------ARR11(2)
                                                                                          --------->ARR11(3)
                                                                                          --------->GATA12
                                                                                          <---------GATA12
                                                                                          --------->AGP1
                                                                                          --------->RVE1(2)
                                                                                     <------ZmHOX2a(2)
                                                                                     ===============
                                        <---------ARR11(2)                           ===============
                                        --------->ARR11(2)                           --------->CCA1(2)
                                        --------->ARR14(2)                          <---------ARR11(2)
                           <---------ANAC46                                         --------->GATA12
                           <---------ANAC58                                         --------->ARR11(2)
                           <---------ANAC58      <---------KAN1                     --------->ARR11(3)
                     <---------ARR11(3) <---------ARR14(2)           <---------ARR11(2)   --------->ARR11(2)
                     --------->ARR11(3) --------->GATA12             --------->GLK1(2)    <---------ARR14(2)
                     <---------GLK1(2)  <---------GLK1(2)   --------->At4g35610     --------->ARR14(2)
                    --------->KAN1      <---------RVE1(2)   <---------ZAT2          <---------ARR14(2)
                   <---------YAB5  --------->MYB52(1)       <---------At4g35610     <---------GATA12
                 ---------->DOF2   <---------DOF5.7(2)      --------->ZAT2          --------->AGP1 <
            <--------P--------->GLK1(2) <---------GATA12  ------->GAMYB            --------->GLK1(1)
 
ccatgagaagaattggtagataaagattcttcgtgtgttaacggattcgcgagtttcacaacgagctgagcgattccatgagactgagatccagatccag  5763700
     --------->ANAC58                                                          <------NtERF2
     --------->ANAC58                                             <---------LBD16
   <---------PCF2                                               <---------ARR14(2)
--------->ALFIN1              --------->DOF5.7(1)     <------NtERF2           ------>NtERF2
------>ALFIN1                --------->DOF5.7(1)     <---------ATERF1(1)--------->MYB52(1)
---ZmHOX2a(1)               ---------->DOF2         <---------DEAR3(1)  <---------DOF5.7(2)
---HSFB2a(2)           <------ZmHOX2a(1)            ---------->CDC5    <---------WRKY12
-----RAV1(2)         --------->ANAC46            <---------At4g35610   --------->ZAT14
-->HSFB2a(2)   --------->ANAC46                  --------->At4g35610--------->LBD16
---LBD16       --------->ANAC58                  --------->ZAT2 --------->GLK1(2)
======HOX2a_HOX2a   <-----------RAV1(2)          <---------ZAT2 --------->ARR14(2)
>CCA1(2)    --------->DOF5.7(1)          --------->YAB1 ------>NtERF2 ----------->HVH21
======HOX2a_HOX2a ------->TEIL--------->DAG2 <----------CDC5   --------->KAN1<---------ANAC46
===HOX2a_HOX2a --------->ANAC58         <---------ATHB12--------->ZAT18<---------WRKY38(1)       ---
------ZmHOX2a(1)  ----------->RAV1(1) --------->WOX13(1)<---------ZAT18<---------ZAT14 <---------GLK1(2)
 
gaggagggacccaataagacgcaccaggaacaaaagggagccaatcaggctgagctcggcgcacaaaaatccggtgaacggcgtcttctagcttctgtat  5763800
                                                            <------ZmHOX2a(2)
                                                           --------->ARR14(2)
                                                           <---------ARR11(2)
                                                           --------->ARR11(2)
                                                           <---------GATA12
                                                       ------>NtERF2
                                                      ----------->HVH21
                                                      --------->DEAR3(1)
                                                      --------->LBD16
                                                      --------->ANAC46
                                                     --------->HSFB2a(2)
                                                 ------>ZmHOX2a(2)
                                                <---------GLK1(1)
                                                --------->GLK1(1)
                                                <------ZmHOX2a(2)
             <-------GAMYB                     <---------AGP1
          <------NtERF2                        --------->ARR14(3)
         ------>NtERF2                         --------->ARR11(3)
        <---------DEAR3(1)                     --------->AGP1
       --------->SPL7(1)                       <---------GATA12
     ----------->HVH21      <---------AtMYB61  <---------ARR11(3)
    --------->DEAR3(2)     <------NtERF2       --------->RVE1(2)
    ------>ZmHOX2a(2)     --------->LBD16      --------->GATA12
   <------ZmHOX2a(2)     <----------CDC5       <-----------ARR10
  <---------ARR14(2)     <------NtERF2         --------->ARR14(2)          ------>ZmHOX2a(2)
  <---------ARR11(2)    <---------LBD16 --------->TOE1(1)  --------->GATA12=========================
  --------->GATA12      --------->At4g35610    <---------ARR11(2)         ==========================
  <---------GATA12      --------->LBD16 --------->TOE2(1)  <---------ARR14(2)
  --------->ARR11(2)    ------>NtERF2  <---------------AtSPL8------>ZmHOX2a(2)  <---------KAN1
  --------->ARR14(2)   --------->DEAR3(1)      --------->ARR11(2)         <------ZmHOX2a(2) --------
 <------ZmHOX2a(1)    --------->ATERF1(1)      <---------ARR14(2)        <---------GATA12  <-------TEIL
------->DOF2<---------MYB46(3)     --------->WOX13(1)<---------HSFB2a(2) --------->GATA12 --------->ALFIN1
 
taaaggatccgacggcgattgagaagccgcggaggtatcaatctcgtacagatctccccgacgatcggaagattgagatcggaatgaaacaaggtgcgac  5763900
                           --------->MYB52(1)
                           <---------ARR11(2)
                           --------->ARR11(2)
                           --------->ARR14(2)
                       <------NtERF2
                       --------->RAP2.3(1)
                      <---------ORA47(2)
                      <---------RAP2.3(1)
                      <---------ERF1
                      <---------ATERF1(1)
                     <---------DEAR3(1)
                     --------->DEAR3(1)
                     --------->ATERF1(2)
                     <---------RAP2.3(2)
                     <---------ANAC46                                                   --------->LBD16
                     <---------RAP2.3(3)                                              ------>ZmHOX2a(2)
                    --------->ATERF1(1)                                              <------ZmHOX2a(2)
                    <------NtERF2                                                   --------->ARR11(2)
                    ------>NtERF2                                                   --------->ARR14(2)
                    <---------ABI4(1)                                               <---------ARR14(2)
                    --------->RAP2.3(1)                                             <---------ARR11(2)
                   <---------DEAR4(2)                                               --------->GATA12
                   <---------ATERF1(1)                                              <---------GATA12
                   <---------RAP2.3(1)                                       --------->HSFB2a(2)
                  <---------DEAR3(1)                                         <---------HSFB2a(2)
                 <---------LBD16                                             <---------HSFC1(1)-----
                <---------O2                                    <------ZmHOX2a(2)  <------ZmHOX2a(1)
                <---------bZIP60(2)                             ==========================HOX2a_HOX2a
             ----------->HVH21                                 --------->GATA12    =================
             ----------->TGA1     <----------DOF2              <---------GATA12   --------->HSFB2a(1)
             <---------KAN1<---------ARR14(2)     --------->ZAT18       --------->ICU4<-------------
    <------ZmHOX2a(1)<---------ATERF1(2)      --------->DAG2   <---------ARR11(3) <---------HSFB2a(1)
===========HOX2a_HOX2a<---------DEAR4(2)     ---------->DOF2   --------->ARR11(3) --------->HSFC1(2)
===========HOX2a_HOX2a------>NtERF2    <---------RVE1(2)     --------->DOF5.7(1)  <---------HSFC1(2)
--->HVH21  <------ZmHOX2a(1)     <---------DOF5.7(1)       ---------->DOF2--------->RVE1(2)  -------
 
gaagggaggagagaggatgacgcggcggcgaaacggcctttggatagagaaagtgaacgagagaaagatcgagccattatctagaaggatccgaagaaaa  5764000
                                                                                                   -
                                                                                                   <
             <------ZmHOX2a(2)                                                                     <
            --------->ARR14(2)                                                                     <
            <---------ARR14(2)                                                                     <
            <---------ARR11(2)                                                                     -
            <---------GATA12                                                                       -
     --------->DEAR3(1)                                                                            <
     ----------->HVH21                                                                       -------
    --------->At4g35610                                                                <---------DOF5.7(1)
 <---------KAN1                                                                       <---------DOF5.7(1)
 <---------YAB5                                                                       <----------DOF2
--------->GLK1(2)                                                *TSS                <---------DAG2<
---->DOF5.7(1)------>ZmHOX2a(2)                            --------->ALFIN1          <---------DOF5.7(1)
====================HOX2a_HOX2a      --------->ICU4        <---------ANAC46       <---------ALFIN1--
----------TaNAC69(2)             --------->At5g28300     <---------ANAC46      <-----------GT1    --
--->DOF2    --------->GATA12    ----------->GT1   <---------RVE1(2)           <-----------GT1-------
 
gagaatcagcgacgagatcggtttctgtttcaacgctgtaattttgagttttggataatgctgtgtgagacagagcttatttttcccacctttttatcgt  5764100
                                               <-----------GT1
                                             <---------AHL20(2)
                                          <---------AHL20(2)
                                          --------->AHL20(3)
                                          <---------AHL20(3)
                                          <---------AHL25(2)
                                         --------->AHL12(1)
                                        <---------YAB1
                                       <---------AHL12(2)
                                      <---------AHL20(2)
                                     --------->ICU4
                                     --------->AHL25(3)
                                    --------->AHL12(2)
                                    --------->AHL12(3)
                                    <---------AHL12(3)
                                    <---------AHL12(2)
                                   --------->AHL12(2)
                                   <---------AHL25(3)
                                   <---------AHL12(2)
                                  --------->AHL12(1)
                                  <---------AHL25(1)
                                  --------->AHL20(2)
                                  --------->AHL12(3)
                                  <---------AHL12(3)
                                  --------->AHL25(1)
                                  <---------AHL25(3)
                                  <---------AHL12(1)
                                 <---------AHL25(2)
                                 --------->AHL25(2)
                                 --------->AHL25(3)
                                 <---------AHL20(1)
                                 <---------AHL12(2)
-------->AHL12(1)                --------->ARR11(3)                    <---------WOX13(2)
---------AHL12(1)                --------->AHL12(1)                    --------->WOX13(2)
---------AHL25(1)                <---------AHL12(1)         ------>NtERF2
---------AHL20(3)                --------->AHL12(2)        ------->GAMYB
---------AHL20(2)                --------->AHL20(1)        --------->RAP2.6(2)
-------->AHL20(2)                <---------ARR11(3)        --------->DEAR3(1)
-------->AHL25(2)               --------->AHL12(3)<----------DOF2 --------->WOX13(2)
---------AHL25(3)           ----------->TBP<---------YAB1 --------->DEAR3(2)
---->GT1 <---------ANAC58  ------>MYB46(1)--------->AHL25(2)<---------RAP2.6(3)
---------AHL25(2)     <-----------GT1--------->AHL20(2)  <---------At4g35610
------->AHL12(2)  <---------YAB1--------->AHL12(2)<---------DAG2  <---------WOX13(2)
------->ICU4    ----------->GT1 --------->YAB1<-----------GT1  <---------MYB59     <----------DOF2
-->YAB1  <---------ANAC58  ------>MYB83--------->AHL12(2)--------->At4g35610      <---------DOF5.7(1)
 
aattttttgtttgcttattttgttattacctacaaaaatatttattattttaactttttcagccgacttaactaaattagctctgtcttttttagtacta  5764200
                                                                                     <---------AHL12(3)
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL20(3)
                                                                                    --------->AHL25(3)
                                                                                    --------->AHL25(1)
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL20(2)
                                                                                    <---------AHL25(1)
                                                                                    <---------AHL25(3)
                                                                                   <---------AHL20(3)
                                                                                   --------->AHL20(2)
                                                                                   <---------AHL12(3)
                                                                                   --------->AHL25(1)
            --------->KAN1                                           ----------------->AGL3
            --------->ATHB12                                  --------->ARR14(2)   --------->AHL20(3)
          <---------GLK1(2)                                   <---------ARR11(2)   --------->AHL12(3)
       --------->ANAC58                                       <---------ARR14(2)   --------->AHL25(2)
       --------->ANAC46                                    <---------ANAC46        --------->AHL25(3)
       --------->ANAC58                                    <---------ANAC58       <---------WOX13(2)
      <---------LBD16                                ------>ZmHOX2a(1)--------------->AGL15
    XXXXXXXXXXXXXXXXXXXX>MIR867                      <---------STY1(1)<---------------AGL15
    --------->MYB46(3)                          <---------CCA1(2)    <-----------------AGL3 ------->TEIL
 <---------KAN1         <-----------GT1         --------->KAN1--------->ARR11(2)  <---------AHL12(2)
<---------KAN4(2) <------ZmHOX2a(1)        <----------DOF2 <---------ANAC58       --------->AHL12(2)
 
tcgaataaccacggattattaggaagtttactacccatggtttagacttttatatcctaggggcgtattcaatctaattttagaaaattaatatgaattt  5764300
                                                          <-----------GT1
                                                     <---------AHL20(3)
                                                     <---------AHL25(1)
                                                     <---------AHL12(3)
                                   ---------->DOF2   --------->AHL20(3)
                             <---------WOX13(2)      <---------AHL12(2)
                             --------->WOX13(2)      --------->AHL12(3)
                            <---------AHL12(1)      --------->YAB1
                          --------->ARR11(3)    --------->YAB5
                          <---------ARR11(3)--------->DOF5.7(1)  <-----------GT1
                 <---------YAB1  ----------------->AGL1 --------->RVE1(2)
       --------->ZAT6 --------->YAB5    ----------->GT1<---------ICU4               <---------WOX13(2)
 
tgtaagtgtaacacaatttgatgaatgaagataatttccaaagtagaaaaatgaataaaaatcacattttacatatatgtgtctgataactaattcaatc  5764400
                                                                                   --------->YAB5
                                                                                   <---------ICU4
                                                                                   <--------ATHB1
                                                                                   -------->ATHB1
                                                                                   --------->ATHB12
                                                                                   --------->ATHB51
                                                                                  <---------YAB1
                                                                                  <---------YAB5
                                                                        --------->ANAC55(2)
                                                                    <-----------HVH21
                                                                    <-----------TGA1
              --------->KAN1                                       --------->ANAC46--------->YAB1
         ----------->GT1                                           --------->DEAR3(1)
        --------->DAG2                                    <---------WOX13(1)      --------->ICU4
       ---------->DOF2                                   --------->WOX13(2)  --------->YAB1
   ----------->RAV1(1)                  <---------YAB1   <---------WOX13(2)--------->RVE1(2)
  <---------ETT(1)       --------->RVE1(2)    ---------->DOF2    <---------At5g28300
 --------->DEAR3(2)      --------->GLK1(2)  ------>ZmHOX2a(2)  --------->MYB46(3) <---------ATHB12
<---------At5g28300 ---------->DOF2   --------->YAB1   <---------YAB1   <---------ANAC55(2)
 
ttttaccgacaaaagtgaaactcgaaagtatctatcttctaacatgatcgaaagtaatctaattgaatcaccgtcacatatcacaatcattggtttttta  5764500
                        <----------DOF2
                        <---------DOF5.7(1)
                <-----------GT1
              <---------AHL25(3)
             <---------AHL12(1)
             --------->AHL25(1)
             --------->AHL12(1)
             <---------ICU4
             <---------AHL20(2)
             <---------AHL25(1)
             --------->AHL12(3)
            <---------AHL12(2)
            --------->AHL25(3)
            --------->AHL12(2)
           --------->AHL12(3)
           <---------AHL12(3)
           --------->AHL12(2)
         --------->AHL25(1)
         --------->AHL12(3)                     <---------GATA12     <---------DOF5.7(1)
         <---------AHL20(2)             <---------CCA1(1)     --------->KAN4(2)
         <---------AHL25(1)             <---------RVE1(1)    --------->YAB5
         --------->AHL20(2)            <---------RVE1(2)     --------->KAN1 ----------->GT1       <-
         <---------AHL12(3)            --------->ARR11(3)   <------ZmHOX2a(2)                 <-----
         <---------AHL20(3)   --------->At4g35610          <---------ARR11(3)                -------
         --------->AHL20(3)   <---------At4g35610<------ZmHOX2a(2)  <----------DOF2          <------
    <---------YAB5     <---------DOF5.7(1)      --------->GATA12   <---------DOF5.7(1)       <------
    <---------ZAT6     <---------DAG2  <---------ARR11(3)  --------->ARR11(3)   --------->KAN1<-----
 
agtcttagtgatataaatatttccagccttttctgctaaatagatattttggatcagaaatagatcattctctttttttttgtaaattcgaaaatagata  5764600
<- Previous    Next ->

AGI:  At1g16840.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G78890.1); similar to hypothetical protein OsI_027317 [Oryza sativa (indica cultivar-group)] (GB:EAZ06085.1)
Range:  from: 5762687    to: 5764066    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version