AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                               --------->YAB5
                                               -------->ATHB1
                                               --------->ATHB12
                                               <---------ICU4
                                               --------->YAB1
                                              <---------YAB5
                                              <---------ATHB12
                                             --------->RVE1(2)
                        --------->DOF5.7(1) ------>MYB83
                      ---------->DOF2       ------>MYB46(1)
                   ----------->GT1  --------------->AtSPL8
               <---------ARR14(2)   <---------------AtSPL8           --------->HSFB2a(1)
               --------->ARR11(2)--------->ARR14(2)                  --------->HSFC1(2)
               <---------GATA12  <---------ARR14(2)                  <---------HSFB2a(1)
              --------->KAN1  <---------------AGL15                  <---------HSFC1(2)
              --------->At4g35610<---------GATA12        --------->ZAT2           <-----------GT1
              <---------At4g35610--------->GATA12        <---------At4g35610 --------->TOE2(3) -----
 <----------DOF2 <-------TEIL<-----------------AGL3      --------->At4g35610 --------->YAB1   <-----
>YAB1<-----------GT1--------->At5g28300   <---------MYB59<---------ZAT2   <----------DOF2     <-----
 
tgtgctttaaactatacagatgcggtaaagagactaaatctggtaccaaatcattgtcttagctggtttcgaaatttctttcttaatactctacattatg  3941100
                                                                        <---------ANAC58
                                                                        <---------ANAC58
                                                                    <---------YAB1
                                    --------->KAN1                 --------->AHL20(3)
                                  <---------AHL25(1)               <---------AHL12(2)
                          --------->ARR11(2)                     <---------YAB1
                         --------->KAN1         --------->DOF5.7(1)--------->AHL12(2)
                       --------->ANAC55(2) <------NtERF2         --------->ICU4
                       <---------ANAC55(2)------>NtERF2       <---------YAB1
                 ------->TEIL     <---------AHL12(3)      --------->ARR11(3)
             <---------GATA12     <---------AHL20(3)      <---------GATA12     <---------DOF5.7(1)
---->YAB5    --------->GATA12     --------->AHL20(2)      --------->GATA12     <---------DAG2
----YAB1    <---------At4g35610   --------->AHL25(1)----------->GT1<---------AHL20(3) ------->TEIL
----YAB5    --------->At4g35610   <---------AHL20(2)--------->YAB5<---------ICU4   <---------YAB1
 
attcaatgtaaatgcagatgtatgttatgtattcgatttatatgcccccaaaaaatggttaaatcttgattattatcgtgtcccttatgaacgttttctt  3941200
                    <------ZmHOX2a(2)                                                     --------->ANAC55(2)
                   --------->ARR11(2)                                                     <---------ANAC58
                   <-----------ARR10                                               <----------DOF2
                   --------->RVE1(2)                                              <---------DOF5.7(1)
                   --------->GATA12                                               <---------DAG2<---
                   <---------ARR11(2)                                    --------->MYB52(1)---------
                   <---------GATA12                          ----------->RAV1(1)------>NtERF2   <---
                <---------ANAC55(2)                         <---------ALFIN1------->GAMYB <---------ANAC58
                <---------ANAC46                           --------->MYB46(3)  <---------ALFIN1-----
                --------->ANAC55(2)                <---------GATA12     --------->MYB46(3)<---------ANAC55(2)
               <---------LBD16            ---------->DOF2  <---------MYB55(2)  --------->RAP2.6(2)
              --------->MYB52(1)    --------->DEAR3(1)   ------>ZmHOX2a(1) --------->MYB46(3)-------
 
ctctcgcattgccaacgttacggatcaactctctcttcatcgcccaaaagaacacatctcctcccaccagagacaacaacggccacctttgttccgtcat  3941300
                          --------->CCA1(2)
                          <------ZmHOX2a(2)        <---------ANAC46
                         --------->GATA12          <---------ANAC58
                         <---------GATA12          <---------ANAC58
                         --------->AGP1        <---------ANAC58
                         <---------ARR14(2)    <---------ANAC58
                         --------->ARR11(2)   --------->ZAT2
                         --------->ARR14(2)   <---------ZAT2
                         --------->ARR11(3)   --------->HSFB2a(1)
                         --------->RVE1(2)    --------->HSFC1(2)                               <----
                         <---------ARR11(3)   <---------HSFC1(2)                               <----
                  --------->YAB1  --------->MYB52(1)                                           <----
            --------->YAB1========================HOX2a_HOX2a                             <---------ANAC46
           <<<<<<<<<ARR2 <---------ARR11(2)   <---------HSFB2a(1)                   <---------TOE1(3)
     <---------ETT(2)---------->DOF2    <-----------RAV1(2)                         <---------TOE2(3)
------ICU4 <---------ATHB12       --------->ARR14(2)                              <---------WRKY12
>LBD16    --------->RVE1(2)       <---------ARR14(2)                             --------->WRKY18(1)
------GLK1(2)   --------->RVE1(2) <---------ARR11(2)                    <----------DOF2   <---------ANAC58
---->ICU4--------->WOX13(1)       --------->ARR11(2)                   <---------DOF5.7(1)<---------ANAC58
-->YAB1------------>CBF--------->DOF5.7(1) <------ZmHOX2a(1)          <---------DOF5.7(1)--------->MYB52(2)
 
aatctctctcgacaatcaaaatcagaaagatccaaagtatcggccaggaagcttgcgtctaggcttcaaggcctcctttccaaggtcaaggttccttggc  3941400
                                                                <---------GATA12
                                                       --------->AHL20(2)       <---------ANAC46
      <---------YAB1                               --------->ANAC58             --------->ALFIN1
 <---------ICU4       --------->GLK1(1)            --------->ANAC58           ------->GAMYB
<---------YAB5        <---------GLK1(1)            --------->ANAC46        --------->MYB52(1)
-----ANAC58          --------->GATA12            --------->ZAT6--------->At4g35610
-----ANAC58<------MYB83                    --------->RVE1(2)   <---------At4g35610--------->ALFIN1
-----ANAC46<------MYB46(1)                <---------KAN1 <------------CBF <---------KAN1      <-----
 
ttgatcattttgtttggtttctgagatttctcttggttaactcgattatctaacacgataaattgcagatggagagcataacggagtgggacttgggatc  3941500
                                                                      <---------ANAC58
                                                                      <---------ANAC58
                              --------->ARR11(3)                      <---------ANAC46
                 --------->WRKY12                                    --------->MYB52(2)
                 --------->WRKY38(1)                             --------->TOE2(1)
                <---------MYB52(1)                               --------->TOE1(1)
         <-----------GT1  <---------ZAT6                    <-----------GT1
   <---------TOE1(2)------->TEIL <----------DOF2          --------->DOF5.7(2)     --------->ANAC46
-ZmHOX2a(2)    <-------GAMYB  <---------ARR11(3)         <----------DOF2        --------->MYB52(1)
 
acttcgaacgtattactccgttgaacctagtgagaactttcaagaagacgagtttttagactttaacctcgttccttgtcttcaaacggagctatggaag  3941600
                 <---------ANAC58
                 <---------ANAC58        --------->At4g35610
               <---------ARR11(3) --------->AHL20(2)
               --------->ARR11(3) <---------AHL25(1)                    ---------->DOF2      -------
           ---------->DOF2     ----------->GT1         --------->ARR11(3)            --------->DOF5.7(1)
        --------->RVE1(2)     ----------->GT1          <---------ARR11(3)    --------->CCA1(2)------
        --------->GLK1(2)   ---------->DOF2 <------ZmHOX2a(1)  --------->At4g35610 ---------->DOF2
 
gctcaaacgagaatcaaagagcttgaggctgaaaagtttaaatcagaggaaactataagatgtctcatcagaaaccaaagaaatgagaaagaagaaacca  3941700
                                                                                                   -
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
               <---------ANAC46                                                            <--------
               <---------ANAC58     --------->DOF5.7(1)         --------->At4g35610        <--------
               <---------ANAC58--------->ANAC58              ---------->DOF2               <--------
      <---------MYB46(3)       --------->ANAC58          ----------->GT1         ---------->DOF2  <-
    <---------MYB52(1)   --------->DAG2                --------->DOF5.7(1)  <---------TOE1(2)     --
-->MYB46(3)    <---------ANAC55(2)---------->DOF2    ---------->DOF2   --------->GLK1(1)   <--------
--->YAB5  --------->YAB5---------->DOF2         ---------->DOF2 <---------At4g35610      -----------
 
ctaatccatttgttgattacttgaaggaaaagttaagcaaagagagggaagaaaagaaaagagttaaagctgagaattctaggttaaagaagaagatttt  3941800
                                                                           <---------ARR11(2)
                                                                           <---------GATA12
                                                                           --------->GATA12
-------->CCA1(2)                                                           --------->ARR14(2)
--------RVE1(2)                                                            --------->ARR11(2)
--------ARR11(2)                                                           <---------ARR14(2)
------->ARR14(2)                                                          <------ZmHOX2a(1)
>ARR11(3)                                                             <---------bZIP60(2)
-ARR11(3)                                                          ----------->HVH21
-ARR14(3)                                                          ----------->TGA1
>ARR14(3)                                                    <---------ARR14(2)
-GATA12       ---------->DOF2                                --------->ARR11(2)
-GLK1(2)   ----------->GT1                                   --------->ARR14(2)
-RVE1(2) <---------YAB5                                      <---------ARR11(2)
--------ARR14(2)                       <-------TEIL         ========================HOX2a_HOX2a
------->ARR11(2)                      --------->CCA1(2)     <------ZmHOX2a(1)------>ZmHOX2a(2)
-ARR14(2)--------->ICU4          --------->DOF5.7(1)  --------->ALFIN1<---------O2       -----------
>ARR10<---------YAB5           ---------->DOF2      --------->ALFIN1  <---------ANAC46 <------------
 
ggatatggagtcatcagtaaatcggttgagaagagaaagagatacaatggagaaggtgtgcgaggaactggtgacgaggatcgatgaattgaaggtgaat  3941900
                                                <---------ANAC46
                                           --------->At4g35610
                                    <-----------RAV1(1)
                                    =================RAV
                                    <---------REM1(1)
                                   --------->ARR11(3)
                                   --------->GATA12        <---------ANAC46
                --------->MYB52(1) <---------GATA12     --------->ALFIN1
             --------->ANAC58     --------->At4g35610--------->GATA12       <---------ZAT6
          <---------SPL7(1)       <---------At4g35610<---------RVE1(2)     <---------TOE2(3)
        --------->ALFIN1        <-----------RAV1(2)  <---------GATA12      <---------TOE1(3)
--------->DOF5.7(1)       <------ZmHOX2a(1)<---------At4g35610    ---------->DOF2
>GT1  --------->ALFIN1 <------ZmHOX2a(1) <-----------RAV1(2)     <------ZmHOX2a(1)  <-------TEIL
---------WRI1--------->ANAC58   ================RAV----------->ARR10--------->DOF5.7(1)
 
acaaggagggtgtgggacgaaacggaggaggagaggcagatgttgcagatggctgagatgtggagggaggaaagggttagggttaagttcatggatgcaa  3942000
<- Previous    Next ->

AGI:  At1g11684.1   
Description:  unknown protein
Range:  from: 3941103    to: 3941300    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g11690.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G50660.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17933.1)
Range:  from: 3941469    to: 3942212    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version