AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         --------->At4g35610
                                                         --------->ZAT2
                                                   <----------DOF2             --------->ANAC46
                                          <---------GLK1(1)                --------->AtMYB61
                                          --------->GLK1(1)               --------->ANAC46
                                         --------->ARR14(2)              ----------->RAV1(1)
                                         <---------ARR14(2)              ==========================RAV
          --------->ANAC58               <---------ARR11(2)         <---------ANAC58
          --------->ANAC58               --------->ARR11(2)----------->HVH21   --------->ANAC58
       <---------ARR11(2)            --------->LBD16     <---------At4g35610   --------->ANAC58
    --------->ALFIN1             --------->ANAC58 <---------ANAC58  <---------ANAC58
-------->MYB52(1)      ---------->DOF2  <------ZmHOX2a(1)<---------ZAT2--------->SPL7(1)
--HVH21--------->ARR11(2)        --------->ANAC58 <---------ANAC58  <---------ANAC46   ----------->RAV1(2)
 
tataacggtggaagcgcaattcataccaaagaaaacaagccgaggaaaccctagctttcgagctgactcttgcgtccaccacaagaaaccgtctgagacc  3416000
                   ==========================bZIP_DOF
                   <---------TGA1a
                   --------->bZIP60(1)
                   <---------bZIP60(1)
          --------->ALFIN1
          ----------->HVH21
         ------->PIF5
         ------->MYC4
         -------->ABF1
         <-------MYC4
         ------->MYC3
         <-------PIF5
         <-------MYC3
         <-------MYC2
         ------->MYC2
        =====================================bZIP_DOF
        --------->ANAC55(2)
        <---------ANAC55(2)
        >>>>>>>>>>ABI5
        <---------bZIP60(2)
        >>>>>>>>>>AtMYC2
        >>>>>>>>>>HY5
        <---------TGA1a
        =====================bZIP_bZIP
        --------->O2                                                                        --------
        <---------O2                                                                    --------->ANAC58
        --------->TGA1a                                                                 <----------ID1
       >>>>>>>>>>>>AtMYC2                                  <------NtERF2                --------->ANAC58
    <-----------HVH21   <---------At4g35610               <---------MYB46(3)           --------->SPL7(1)
   ----------->HVH21    --------->At4g35610         <---------ANAC58          --------->DOF5.7(1)
------->TEIL    ----------->HVH21 ---------->DOF2   <---------ANAC58---------->DOF2   <------ZmHOX2a(1)
 
atgaaactgacacgtggcagtgacatgagctctcgctcaaagtctgcctgcattgacttggtggctcttgtgaaaggaacgaagagggaggacgacaaag  3416100
                                 ------>ZmHOX2a(2)
                                <---------GLK1(1)
                                <---------KAN1
                                --------->KAN1
                                --------->GLK1(1)
                                <------ZmHOX2a(2)
                               <---------ARR14(2)
                               --------->ARR14(2)
                               <---------ARR11(3)
                               --------->ARR11(3)
                         <---------ZAT2
                         --------->ALFIN1
                        <---------MYB46(3)
                        --------->LBD16
                        --------->MYB55(2)
                        ------>NtERF2<---------HSFB2a(2)
                      <------NtERF2  --------->HSFB2a(2)
                      --------->ATERF1(1)                                           --------->LBD16
                      <---------LBD16--------->LBD16          <---------ETT(2)     <---------ANAC46
                     ------>NtERF2  <---------LBD16       <-------TEIL            --------->ATERF1(1)
                    --------->ANAC46--------->ANAC46  <---------------AtSPL8      <---------LBD16
                    --------->DEAR3(1)                <---------------AtSPL3  <---------ANAC58
                    <---------DEAR3(1)----------->HVH21   --------->SPL7(1)   <---------ANAC58
               --------->ANAC46<---------ARR11(2)     --------------->AtSPL3 <---------AtMYB61
            <---------ZAT18    --------->GATA12       --------->DOF5.7(1)    <-----------RAV1(1)<---
            <---------ZAT14    --------->ARR11(2)     --------->DAG2       <----------DOF2     <----
            --------->ZAT18    <---------GATA12  --------->LBD16     <---------MYB46(3)   <---------KAN1
      <-----------HVH21<---------ANAC46        <---------LBD16--------->DEAR3(1)  <------NtERF2<----
   <---------KAN1----------->HVH21 <---------LBD16  ---------->DOF2 <---------AtMYB61<------NtERF2 -
-->DOF2     --------->ZAT14--------->ALFIN1--------->DOF5.7(2)<---------DEAR3(1) ------>NtERF2 <----
 
cagggagtttgtcagtgcactcgacgccgggtgggatctccgggacgttatcagggaaaggtacgtcgacgatggtcgctttggtgccggagagtgagtc  3416200
          <---------DEAR3(2)
          <---------MYB46(3)
          ----------->GT1
         <---------DEAR3(1)
       <------ZmHOX2a(1)             <---------ANAC46
      --------->DOF5.7(1)         ----------->TGA1
   ---------->DOF2                ----------->HVH21         --------->ALFIN1
 <---------YAB1                  <-----------HVH21        --------->ALFIN1
------DOF5.7(2)             --------->DOF5.7(1)          <------ZmHOX2a(1)                        --
-----WRKY45            ----------->GT1            --------->LBD16                 --------->WOX13(2)
-----WRKY38(1)        <---------AtMYB61           ------>NtERF2        <------ZmHOX2a(1)         <--
-------->YAB5         --------->ALFIN1          <---------LBD16  <---------KAN1   <---------WOX13(2)
-----WRKY12    ---------->DOF2 <---------DEAR3(1)<---------DEAR3(1)--------->DOF5.7(1)        <-----
 
aacgatgaaaggacggttcaaaggagtggtgaagacggtgacggagatgtctccggcgaaggagtgggataagaggagacgagctaattggagcatagga  3416300
                                                                              ----------->HVH21
                                                                          --------->CCA1(2)
                                                                          <------ZmHOX2a(2)
                                                                         --------->ARR14(2)
                                                                         <---------ARR14(2)
                                                                         <---------RVE1(2)
                                                                         --------->GATA12
                                                                         <---------GATA12
                                                                         --------->ARR11(3)
                                                                        <---------GLK1(1)
                                                                        --------->GLK1(1)
                                                                 <---------WOX13(2)
                                                                 --------->WOX13(2)
                                                                 <------------CBF
                                                               --------->AHL20(2)
                                        <---------DAG2         <---------AHL20(2)
                                  <-------MYC2                 <---------AHL25(1)
                                  ------->MYC3                 <---------AHL12(3)
                                  ------->PIF5                 <---------AHL25(3)
                                  <-------PIF5                 --------->AHL25(1)
                                  ------->MYC2                <---------AHL20(2)
                                  <-------MYC3                --------->AHL20(2)
       ====================================bZIP_DOF           --------->AHL20(3)
       <----------DOF2           <---------TGA1a              --------->AHL25(3)
      <---------DOF5.7(1)        --------->TGA1a              <---------AHL20(3)
   --------->ZAT18               <---------O2                 <---------AHL25(2)
   <---------ZAT18               <---------ANAC55(2)          --------->AHL25(2)
 <-------MYC3                    --------->ANAC46             --------->AHL25(1)
 ------->MYC3         <----------ID1    <----------DOF2  <---------ANAC58--------->AGP1
------->YAB1        ----------->GT1     <---------DOF5.7(1)   <---------AHL25(1)
-------YAB5    --------->ANAC58  --------->O2            <---------ANAC58<---------ARR11(3)
-ZmHOX2a(1)    --------->ANAC58  ==================bZIP_DOF  <---------KAN1------>ZmHOX2a(2)
 
atcatgtgccctttggacaagtatgggaacaaaaccacgtgaactttttctaactccattgcgaatttaattgagagatctgtgactgtgcataggcctc  3416400
                                                             ------>ZmHOX2a(2)
                                                             =======================HOX2a_HOX2a
                                                            <------ZmHOX2a(2)
                                                            ========================HOX2a_HOX2a
                                                            --------->CCA1(2)
                                                           --------->RVE1(2)
                                                           <-----------ARR10
                                                           --------->ARR11(2)
                                                           <---------ARR11(2)
                                                           <---------ARR14(2)
                                                           --------->ARR14(2)
                                                           --------->ARR11(3)
                                                           <---------ARR11(3)
                                                           <---------RVE1(2)
                                                           <---------AGP1
                                                           --------->AGP1
                                                           --------->GATA12
                                                           <---------GATA12
                                                          <---------CCA1(2)
                                                      ------>ZmHOX2a(2)
                                                      ==============================HOX2a_HOX2a
                                                     ===============================HOX2a_HOX2a
                                                     <---------GLK1(1)
                                                     <------ZmHOX2a(2)
                                                    <---------GATA12
                                                    <---------ARR11(3)
               ------->TEIL                         --------->ARR11(3)
              <---------CCA1(2)                     --------->GATA12
          <------------CBF                  --------->MYB46(3)                           --------->KAN1
     <---------ANAC46            ---------->DOF2   --------->GLK1(1)         ------>ZmHOX2a(1)
 
tctctgtttcttatattgtatctctctatgtataaacaaagacttcatccactgagatctcagatctgtgcataggtctcctctctgttttcttatgcta  3416500
                                                                               --------->KAN1
                                                                              <---------AHL25(2)
                                                                              --------->AHL25(2)
                           <---------YAB5                                     --------->AHL20(3)
                 ------>ZmHOX2a(2)                                            <---------AHL25(1)
                <------ZmHOX2a(2)                                             <---------AHL20(2)
                --------->CCA1(2)                                             <---------AHL20(3)
               <---------GATA12                                            <---------ARR11(3)
               --------->GATA12                                    --------->AHL20(2)
               <---------ARR14(2)                                 <---------YAB1
               --------->ARR14(2)                                --------->AHL20(3)
               --------->AGP1                                    <---------AHL20(3)
               <---------RVE1(2)                                 --------->AHL20(2)
               --------->ARR11(3)                           ------------>CBF  --------->AHL25(1)
               <---------ARR11(3)                         <---------ZAT6   --------->ARR11(3)
              <---------GLK1(1)      ---------->DOF2  <---------YAB1<---------AHL20(2)
             ----------->ARR10   <---------TOE2(3) --------->ICU4--------->AHL25(2)       <---------ATHB12
         --------->YAB1  ----------->GT1       ------------>CBF  <---------AHL25(2)   ------------>CBF
 
tctctctatgtataatgagatctgtgcctagttattaacatatagcaacttgcaattactagtgacaatattatataagattttattctaccaatgaatt  3416600
                                       <---------TOE2(3)
                                   ------>ZmHOX2a(1)
                                  --------->TOE2(3)
                                 ------>ZmHOX2a(2)
                                <------ZmHOX2a(2)
                               <---------ARR14(2)
                               <---------ARR11(2)                           ---------->DOF2
                               --------->ARR11(2)                     ------>MYB83
                               --------->ARR14(2)               --------->DOF5.7(1)
                               <---------RVE1(2)         --------->AHL20(2)<---------AHL20(2)
                               --------->GATA12       --------->YAB1  ------>MYB46(1)
   ------>ZmHOX2a(2)           ------->TEIL      <-----------------------TaNAC69(2)   <---------ARR11(3)
 <---------ARR11(3)            <---------GATA12 --------->CCA1(2)    ----------->RAV1(1)
 <---------GATA12        <---------RVE1(2)     <----------ID1 ---------->DOF2<---------TOE2(3)
--------->ZAT14      <------------CBF---------->DOF2----------->GT1 --------->AtMYB61 --------->ARR11(3)
 
cagtgatctaacatctatgacttccattgctatggatcctcaaaggtagagagacaagtataaaataaagaccaacatttaaagtataagataatactgt  3416700
             --------->AHL12(1)
             <---------AHL12(1)
       <-------TEIL
      --------->ARR14(1)
      --------->CCA1(2)
     <---------ARR14(2)
     --------->ARR14(2)
     --------->ARR11(1)                     <----------DOF2
     <---------GLK1(2)                     <---------DOF5.7(1)
     <---------GATA12               <---------ICU4
    --------->KAN1                  --------->YAB1                                    <---------RVE1(2)
   <---------YAB5            ----------->GT1<---------MYB52(1)                  <----------DOF2
  <---------TOE2(3)  --------->KAN1<---------ATHB12                            <---------DOF5.7(1)<-
 ---------->DOF2   <---------CCA1(2)--------->YAB5 <---------ANAC46 --------->MYB52(1)--------->GATA12
 
ggattaaagattcgaaattttcatatattcacttgtaaatcatcaccctttgttttgtgttcttggggttctaacgggatgctcttttggattttgtgtt  3416800
                                                           <---------WOX13(1)
                                                          <---------WOX13(2)                     ---
                                                          --------->WOX13(2)                     ---
                                               <---------ARR11(3)                                ---
                                               --------->ARR11(3)                                ---
                                              --------->GLK1(1) --------->YAB1                ------
       ----------->GT1                        <---------GLK1(1)<---------YAB1               ========
      --------->ANAC58                      <------ZmHOX2a(1) <---------TOE2(3)             --------
      --------->ANAC58            <---------MYB52(1)      --------->AHL12(2)    --------->WOX13(1)
---------DOF2      <------ZmHOX2a(1)  <---------YAB5    <---------AHL20(2)    <---------ATHB12------
 
tcttttcacaaggaaaaacagaggagaaaacaatgttgttagtcataggagttcttgagttaattgatgatagttcatgaaatcaatcccatttagcctg  3416900
<- Previous    Next ->

AGI:  At1g10400.1   
Description:  UDP-glycosyltransferase/ transferase, transferring glycosyl groups. similar to transferase, transferring glycosyl groups [Arabidopsis thaliana] (TAIR:AT5G14860.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO14794.1); contains InterPro domain UDP-glucuronosyl/UDP-glucosyltransferase; (InterPro:IPR002213); contains InterPro domain Tudor; (InterPro:IPR002999)
Range:  from: 3414853    to: 3416359    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g10410.1   
Description:  similar to CW14 [Arabidopsis thaliana] (TAIR:AT1G59650.1); similar to expressed protein [Oryza sativa (japonica cultivar-group)] (GB:ABF98316.1); contains InterPro domain Protein of unknown function DUF1336 (InterPro:IPR009769)
Range:  from: 3416681    to: 3419640    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version