AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                             --------->YAB1
                                                                          --------->TOE2(3)
                                                                       --------->ARR11(2)
                                    --------->ATHB12                   <---------ARR11(2)
                                   --------->ICU4               --------->AHL12(1)
                                   <---------YAB1               <---------AHL12(1)
                                 --------->YAB1                <---------AHL12(2)
                                --------->ICU4            --------->YAB5 <-------TEIL
                                --------->DOF5.7(1)       --------->YAB1<------ZmHOX2a(2)
                              ---------->DOF2            <---------YAB1--------->AGP1
                           --------->ANAC58          <<<<<<<<<GATA-1   --------->GATA12
                           --------->ANAC58       --------->AHL12(1)   --------->RVE1(2)
                      --------->TOE2(3)           <---------AHL12(1)   <---------GATA12
                     --------->ANAC46           <---------WOX13(2)     --------->ARR14(2)
                  --------->ARR11(2)<---------ICU4<---------AHL25(3)   <---------ARR14(2)          -
                  <---------ARR11(2)--------->YAB5<---------AHL20(2)  --------->At4g35610    <------
           --------->KAN1---------->DOF2        --------->WOX13(2)--------->RVE1(2)  --------->WRKY12
  <---------REM1(2)<---------DOF5.7(2)     --------->RVE1(2)  --------->AHL12(2)     --------->WRKY38(1)
 
aactatacacacatatattcgtaaacgtaaaagcaaagatgattactatctaatttatctatgataaaaaatcagatccataatcaagttgactgtgcat  2873100
                                                                                    --------->CCA1(2)
                                                                                    --------->KAN1
                                                                                   --------->ARR11(2)
                                                                                   --------->ARR14(2)
                                                                                   <---------ARR11(2)
                                                                                   <---------ARR14(2)
                                                                                  --------->KAN1
                                                                                --------->AHL20(2)
        ------>ZmHOX2a(2)                     --------->DOF5.7(1)               <---------AHL20(2)
      <---------ARR11(3)                    ---------->DOF2                     --------->AHL12(3)
      <---------ARR11(2)               <---------AHL12(3)                       <---------AHL12(3)
      --------->GATA12                 <---------AHL20(2)                     --------->AHL20(2)
      --------->ARR11(2)               --------->AHL20(2)                     --------->AHL12(3)  --
      --------->ARR14(2)               --------->AHL20(3)                <---------YAB5     --------
      <---------ARR14(2)               <---------AHL20(3)            <---------DOF5.7(1)  <---------SPL7(1)
      <---------GATA12         --------->TOE2(3)                   <---------RAP2.6(3)    ----------
      <---------AGP1           --------->TOE2(2)          --------->ATHB12--------->YAB1 --------->LBD16
      --------->RVE1(2)        --------->TOE1(2)      <---------YAB1<---------MYB52(1)  --------->ANAC46
---------->HVH21       --------->ANAC58<---------AHL25(1)<---------YAB1  <---------YAB1<---------LBD16
---AtLEC2              --------->ANAC58--------->AHL25(1)--------->ICU4<-----------GT1--------->ANAC46
 
gggtgactggatctaaatttctaaacaagacaaacctaagattaaaataaagacgttttgattattgagccgttttatcatatatatatacgcgggacga  2873200
                         <---------AHL25(3)
                         <---------AHL20(3)
                         <---------AHL20(1)
                         --------->AHL20(2)
                         <---------AHL20(2)
                         --------->AHL25(1)
                         --------->AHL20(3)
                         <---------AHL25(2)
                         --------->AHL20(1)
                       --------->WOX13(2)
                     <---------AHL20(2)
                     <---------AHL25(3)
                     --------->AHL20(2)
                    --------->AHL20(2)
                    --------->AHL25(3)
                   <---------AHL12(2)
                   --------->AHL12(2)
                 <---------AHL12(1)
                 --------->ICU4
                --------->AHL12(2)
                --------->AHL20(3)
                --------->AHL25(2)
                <---------AHL12(3)
                <---------AHL20(3)
                <---------AHL12(2)
                --------->AHL12(3)
                --------->AHL25(3)
                <---------AHL25(2)
               --------->AHL12(3)
               <---------AHL12(3)
               --------->AHL20(2)
               --------->AHL20(3)                     --------->YAB1
               <---------AHL20(3)                    <---------AHL12(1)
               <---------AHL25(1)                   --------->AHL20(2)
               <---------AHL25(2)                   --------->AHL25(2)
               --------->YAB1                       <---------AHL25(2)
      --------->GATA12 <---------WOX13(2)           --------->AHL20(3)
------->KAN1   <---------AHL25(3)               --------->ANAC46
->SPL7(1)   --------->YAB1        <---------ANAC46  <---------AHL20(3)   <---------RVE1(2)      ----
->HVH21 --------->RVE1(2)<---------AHL25(1)   --------->ANAC46          --------->ATHB12        ----
 
cctattctaaatctctaataatatttaataaaatgctacttgtgtttctacacaaaataataagcgaacacagtttgatttgcccaagcgtccaagacca  2873300
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                         -----------
                                                                                       =============
                                                                                       <---------ANAC55(2)
                                                                                       <---------ANAC58
                                                                                       <---------ANAC46
                                                                                       <---------ANAC55(1)
                                                                                       <---------bZIP60(2)
                                                                                       <---------TGA1a
                                                                                       <---------O2
                                                                                       <---------ANAC58
                                                                                       --------->O2
                                                                                    ----------->HVH21
                  --------->AHL12(2)                                            <---------AHL12(2)
                  <---------AHL12(2)                                            <---------AHL12(3)
         <---------ATHB12                                                     --------->AHL25(2)
        --------->ANAC46                                                      <---------AHL20(3)
       --------->At4g35610                   ---------->DOF2                  --------->AHL25(1)
     --------->ZAT14                   --------->CCA1(2)                      --------->AHL12(3)
     <---------ZAT14                  --------->ARR11(3) --------->ARR11(3)   <---------AHL12(3)   -
     --------->ZAT18                  <---------ARR11(3) <---------RVE1(2)    --------->AHL20(3)----
----->ANAC58     <---------AHL20(2)   <---------GATA12 <---------YAB5         --------->AHL20(2)----
----->ANAC58  ----------->GT1         --------->GATA12 <---------YAB1 <----------ID1----------->TGA1
 
cgaccaagtccactgaatattaaaaattgagcgaaaaacaagatttagaaaagtttttatgattttgttcaaaaaaacaaaaaaaatatgacgtgtaaat  2873400
       ---------->DOF2
     <---------YAB1
  <---------AHL12(1)
  --------->AHL12(1)                                                                --------->ARR14(2)
 --------->AHL12(2)                                                        --------->HSFB2a(1)
 <---------AHL12(2)                                                        <---------HSFC1(2)
--->AHL12(2)                                                               <---------HSFB2a(1)
--->WOX13(2)                                 ------>ZmHOX2a(1)     <---------At4g35610   --------->ANAC46
----AHL12(2)                              <---------ATHB12         *TSS    --------->HSFC1(2)
----WOX13(2)                             --------->ARR14(2)        --------->At4g35610  ------>ZmHOX2a(1)
>GT1--------->RVE1(2)                    <---------ARR14(2)     --------->At4g35610 <---------ARR14(2)
==================bZIP_DOF               --------->ARR11(2)     --------->ZAT2     --------->HSFC1(2)
-------->AHL20(2)                     ------------>CBF          <---------At4g35610--------->HSFB2a(1)
----->AHL20(2)                      --------->RVE1(2)    --------->KAN1  <---------GLK1(2)         <
----->YAB1              --------->At4g35610 --------->TOE2(3)   <---------ZAT2     <---------HSFC1(2)
 
tataaaatatcaaagtgtccagagaccagttgacaaaaacatccaatcctcaagttgcataagttcgagctgctcagaaacttcgaagttcctcacaact  2873500
                  <---------ARR14(2)
                  --------->ARR14(2)
         <---------DOF5.7(1)
         <----------DOF2                                             --------->DOF5.7(1)
         <---------DAG2     <---------HSFB2a(2)          <----------ID1
       ------>MYB46(1)      --------->HSFB2a(2)          ----------->GT1
       ------>MYB83        ----------------->AG        ---------->DOF2      ---------->DOF2   <-----
      <---------ALFIN1     ----------------->AGL1 ------------------------>ANAC81             <-----
     --------->MYB46(3) <----------DOF2          ---------->DOF2   ---------->DOF2       <------ZmHOX2a(1)
  <-----------GT1 --------->ARR11(3)            ------------------------>ANAC81       <------ZmHOX2a(1)
<----------DOF2  <---------CCA1(2)            --------->ANAC58---------->DOF2 --------->DOF5.7(1)
---------DOF5.7(1)--------->ARR11(2)          --------->ANAC58--------->DOF5.7(1)  <-----------RAV1(2)
 
cttctttacccacttttcttatatctgctttccaaaacagagaaaccccaagaaaagaaaaagaaaaaagaaaagagaagaaagaagcaggaggagactt  2873600
                                                                  --------->HSFB2a(1)
                                                                  <---------HSFC1(2)
                                                        <---------ANAC55(1)
                                                        <---------ANAC58
                                                        ===================bZIP_DOF
                                                        --------->ANAC55(2)
                                                        <---------ANAC55(2)
                                                        <---------TGA1a
                                                        <---------ANAC58
                                                        ===================bZIP_DOF
                                        <------ZmHOX2a(1)--------->TOE1(2)                        --
                              ----------->GT1           --------->O2                              --
                           --------->DAG2   <---------ARR11(3)    --------->HSFC1(2)            <---
                           --------->DOF5.7(1)          <---------O2                          ------
                          ---------->DOF2   --------->ARR11(3)  ---------->DOF2               ------
                          --------->DOF5.7(1)           --------->TGA1a                       ------
               --------->DOF5.7(1)   <---------LBD16  <---------KAN1 --------->ZAT18          <-----
----DAG2<----------ID1    ========================================bZIP_DOF--------->MYB52(1)  <-----
-----DOF2    ---------->DOF2--------->DOF5.7(1)    <---------YAB5 <---------HSFB2a(1)<----------DOF2
 
tttggaatggagagacaaaagagcatggaaaaagggttactcaggaagagcttaagcatacgtgagagaaagttccctaacgaagacgctttcttagaat  2873700
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                          --------->MYB52(2)
                                                                                          <---------
         <------ZmHOX2a(1)                                         ------>NtERF2          <---------MYB46(3)
<----------DOF2              --------->ANAC58                   <---------At5g28300     ============
------->LBD16                --------->ANAC58                  <-----------GT1          <----------DOF2
--------->GT1             --------->WRKY18(1)                  <---------ARR11(2)      <---------DOF5.7(1)
------LBD16       ------>NtERF2                                --------->ARR11(2)   <---------ALFIN1
--->GLK1(2)       --------->LBD16                            <-----------HVH21     --------->At4g35610
--->ARR14(2)     --------->ANAC46                           <---------ZAT6         <---------At4g35610
--->ARR11(2)    <---------LBD16                           <---------ANAC58       ---------->CDC5<---
----ARR14(2)<---------HSFC1(2)     --------->TOE2(3)      <---------ANAC58      ------>ZmHOX2a(1)  -
----ARR11(2)--------->HSFC1(2)     --------->TOE1(3)      <---------ANAC46     --------->TOE2(3)<---
 
ccggtttatcgaggaagtctccgcgagaggtcaagaaacctcaaaacgacgatggtgaatgtcgtgttaccgcctctgttttcctcagcacctttgttgc  2873800
                                                                                  --------->ARR14(3)
                          <---------O2                                            <-----------ARR10
                          --------->O2                                            --------->RVE1(2)
           xxxxxxxxxxxxxxxxxxx>smallRNA(si3)                                      <---------ARR14(3)
       <---------DOF5.7(1)<---------ANAC46                                        --------->ARR14(2)
-------->ARR11(2)         <---------ANAC55(1)                                     <---------ARR14(2)
-------->RVE1(2)          <---------ANAC58                                  <-----------GT1
---------ARR11(2)         --------->bZIP60(1)                         --------->MYB46(3)
---------ARR14(2)         <---------bZIP60(1)                        ------>MYB83 <---------ARR11(3)
------ANAC58              =========================bZIP_DOF          ------>MYB46(1)
-------------AGL1         <---------TGA1a                            -------->P   --------->ARR11(3)
------------>AGL1         --------->TGA1a                           --------->MYB55(1)
------------>AG      <---------MYB46(3)                             --------->MYB52(1)
-------------AGL2    --------->ALFIN1                              <---------MYB46(2)
--RAV1(1)------>ZmHOX2a(1)<---------ANAC58                         --------->MYB46(3)
====================================bZIP_DOF<---------ANAC58       --------->AtMYB61
------ANAC58   ------->TEIL                 <---------ANAC58       <---------MYB111(2)
-------->ARR14(2)  <---------MYB52(1)   <----------DOF2            <---------MYB111(1)   --------->LBD16
------ANAC46 <---------ZAT14           <---------DOF5.7(1)   <-------TEIL<---------GLK1(2)  <-------
 
cgtatcaggctccttctgtaccggttgtggcgtgagtcttcttcttttcttgattcaatctcggttcataccaaccgattttcaatatcttccgagtttc  2873900
                                                                                --------->ZAT2
                                                           <---------MYB46(3)  --------->ANAC58
                                                           <------MYB83        --------->ANAC46
                                                           <------MYB46(1)--------->ZAT18
                                    <----------DOF2    <---------MYB46(3) <---------ZAT18
                              ------->TEIL             <------MYB46(1)    <---------ZAT14
                            <---------ZAT14            <------MYB83       <-------TEIL
                        <-----------GT1         <---------MYB52(1)        --------->ZAT14
                     --------->WOX13(2)<---------WOX13(2) <---------AtMYB61    --------->ANAC58
                     <---------WOX13(2)--------->WOX13(2)<--------P   <---------MYB46(3)        ----
--KAN1          ----------->GT1--------->DEAR3(2)     <---------TOE1(2)<---------ANAC46         <---
 
ggtttgactctgaatttgaaggtgaatttactgaaccggcttaatttctcggttttgtaggttggtttttcatcgggtgcacaagcagggattaccaaag  2874000
<- Previous    Next ->

AGI:  At1g08930.1   
Description:  ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar:hydrogen ion symporter. Identical to Sugar transporter ERD6 (ERD6) [Arabidopsis Thaliana] (GB:O04036;GB:O65799); similar to sugar transporter, putative [Arabidopsis thaliana] (TAIR:AT1G08920.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68582.1); contains InterPro domain General substrate transporter; (InterPro:IPR005828); contains InterPro domain Major facilitator superfamily; (InterPro:IPR007114); contains InterPro domain Sugar transporter, conserved site; (InterPro:IPR005829); contains InterPro domain MFS general substrate transporter (I
Range:  from: 2873468    to: 2877226    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version