AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                            <---------AHL12(2)
                                           --------->AHL20(2)
                                           <---------AHL20(2)
                                           <---------AHL25(3)
                                         --------->AHL12(2)
                                  <---------TOE2(3)
                                 ---------->DOF2
                               <---------YAB1
                            --------->AHL20(2)                  <-----------GT1
   <---------WOX13(2)       <---------AHL20(2)               <---------AHL12(2)
   --------->WOX13(2)       --------->AHL20(3)               --------->AHL12(2)         --------->AHL20(2)
 --------->AHL25(3)         <---------AHL20(3)              <---------AHL12(1)        --------->ANAC58
 <---------AHL20(2)         --------->AHL25(3) <---------AHL25(3)      ----------->GT1--------->ANAC58
 --------->AHL20(2)         <---------YAB1--------->AHL20(2)--------->AHL12(1)<---------AHL12(2)
----TOE2(3)           <----------DOF2   --------->YAB1  --------->ANAC58     --------->AHL20(2)
-YAB1                 <---------DAG2   <---------YAB1   --------->ANAC58     --------->YAB1       <-
 
gtttttaattttaaaaattgttcaactttatattattaaagtataataaataaaaccacaagaaaatttacaaaatgtaataaaaaaccaagtaaatgga  2805000
                                         --------->DOF5.7(1)
                                       ---------->DOF2
                                    ----------->RAV1(1)
                                   <----------ID1
                                 --------->ANAC58                   ------>ZmHOX2a(1)
                               --------->SPL7(1)                    --------->LBD16
        <---------REM1(1)     <------NtERF2           <----------DOF2
     <---------AtMYB61      <---------ANAC46  <------ZmHOX2a(1)--------->GLK1(1)
 <-------TEIL ----------->RAV1(1)--------->ANAC58    <---------DOF5.7(1)        ----------->HVH21
-----ZmHOX2a(1)         --------->DOF5.7(1)  --------->DOF5.7(1)  ----------->RAV1(2)             <-
 
aggatgcattggtgtagccacataagtaggggcggaaggcaacaaagaaggagccatctttatcgcaactcctgaaactgagtctgaccctctacttact  2805100
                                                                                             -------
                                                                                             -------
                                                                                             -------
                                      <---------------AtSPL3                            --------->ANAC58
                     --------->TOE2(3)<---------ICU4                                    --------->ANAC58
        --------->At4g35610           <---------------AtSPL8                            --------->ANAC46
        <---------At4g35610    --------->GATA12                                 --------->REM1(2)
    <-----------RAV1(1)        --------->RVE1(2)                                --------->ZAT14
<---------AHL20(2)   --------->YAB1  --------->ICU4                             <---------ZAT14 ----
---------DOF2    --------->KAN1<---------GATA12                                --------->ALFIN1-----
 
tcttttattgctgctctctctcattcttaattccaatctaataagtacgggctctgctagtacagatagagagagagagagagtgtagaccaagacacac  2805200
                                                                                 --------->ZAT14
                                                                                 <---------ZAT18
      --------->MYB52(1)                                                         <---------ZAT14
      ----------->RAV1(1)                                                  -------->P <---------DOF5.7(1)
     --------->ANAC46                                                      ------->TEIL
 ----------->RAV1(1)                                                   --------->RVE1(2)
--------->ANAC46                                                       <-----------ARR10
-->ANAC58                                              <---------ANAC58--------->GLK1(2)
-->ANAC46                                              <---------ANAC58--------->GATA12
-->ANAC58------->GAMYB   --------->TOE2(3)        ------>ZmHOX2a(1)    <---------GATA12         <---
------->RAV1(1)--------->DOF5.7(1)          --------->KAN1             <---------ARR11(3)     <-----
---->ANAC46  ---------->DOF2           <----------DOF2 <---------ANAC46--------->ARR11(3)   <-------
 
aacacaacacaacagagaaagagaattacattagttttttttctttcacattcctcttgcttattgctcttcaaaatctacctgtacactcttctctttt  2805300
                                     <---------YAB1
                                    <---------AHL25(3)
                                    --------->AHL25(2)
                                    --------->AHL20(3)
                                    --------->AHL20(2)
                                    <---------AHL12(3)
                                    <---------AHL20(3)
                                    --------->AHL12(3)
                                   --------->AHL20(2)
                                   <---------AHL12(1)
                                   <---------AHL20(2)
                                   --------->AHL25(1)
                                   <---------AHL25(3)
                                   <---------AHL25(1)
                                   --------->AHL12(1)
                                  --------->ICU4
                                  <---------YAB1
                                 --------->AHL12(2)
                                 --------->WOX13(2)
                                 <---------WOX13(2)
                                 <---------AHL12(2)
                                --------->YAB5
                                <---------AHL25(3)
                                <---------ICU4
                               <---------AHL20(2)
                               <---------AHL25(3)
                               --------->AHL12(3)
                               <---------AHL12(1)
                               <---------AHL12(3)
                               --------->ICU4
                               <---------ATHB51
                               --------->AHL12(1)
                               --------->AHL20(2)
                               --------->AHL25(2)
                               --------->AHL25(3)
                               --------->AHL25(1)
                               <---------AHL25(1)
                              --------->AHL25(3)
                              --------->AHL25(2)
                              <---------AHL12(2)
                              <---------AHL25(2)
                              <---------AHL20(3)              <---------ANAC58
                              --------->AHL12(3)          <----------DOF2
                              --------->AHL12(2)         <---------DOF5.7(1)                 <------
     <---------ANAC46         <---------AHL12(3)    <---------DOF5.7(1)                      <------
 <---------ANAC58             --------->AHL20(3)    <----------DOF2                    <---------DAG2
 <---------ANAC58            --------->YAB1        <---------DOF5.7(1)    ---------->ID1   <--------
---------CBF                 --------->AHL12(2)   <---------DOF5.7(1)    *TSS          <----------DOF2
----AHL20(2)             ----------->TBP        <---------ZAT18<----------DOF2        <---------DOF5.7(1)
---DOF2                ------>ZmHOX2a(1)       ---------->ID1 <---------ANAC58    <-----------GT1
 
attgtcttgtttgtataaatcatctcctacaaaaataattaatataagttgtcccctttctctttgcttctctgtttttcgcaattttctctttttgatt  2805400
                                                                                    <---------KAN1
                                                                                   <---------ARR14(2)
                                                 ===============HOX2a_HOX2a        --------->GLK1(2)
                                                 ------>ZmHOX2a(2)                 <---------ARR11(1)
                                            ------>ZmHOX2a(2)                      --------->ARR14(2)
                                            ====================HOX2a_HOX2a        <---------GATA12
                                           <---------At4g35610                     --------->ARR11(2)
                                           <------ZmHOX2a(2)                       <-----------ARR10
                                           --------->CCA1(2)                       <---------ARR11(2)
                                           =====================HOX2a_HOX2a        ------->TEIL<----
                    <---------ALFIN1      <---------RVE1(2)                       <---------CCA1(2)
                   <---------ZAT14        --------->ARR11(3)            --------->LBD16       ------
                   --------->ZAT14        <---------AGP1               <---------ANAC46       ------
                   <---------ZAT18        --------->GATA12            ------>NtERF2--------->GATA12
                  --------->AtMYB61       <---------GATA12            <---------At4g35610    -------
                  <---------ALFIN1        <---------ARR14(2)          --------->At4g35610    <------
                 --------->ANAC46         --------->ARR14(2)          <---------LBD16        -------
               --------->ANAC46           --------->AGP1            <---------DEAR3(1)      <-------
            --------->ARR14(2)      <---------At4g35610  ------>ZmHOX2a(1)<---------ARR14(2)--------
      <---------ANAC46--------->ANAC58    <---------ARR11(3)  --------->KAN1      <---------ARR14(1)
      <---------ANAC58--------->ANAC46   --------->GLK1(1)<---------TOE2(2)     <---------ANAC58
---RVE1(2)  --------->ARR11(2) <---------ANAC58 --------->GLK1(1)  <---------At4g35610      <------NtERF2
---GLK1(2)  --------->GATA12   <---------ANAC58--------->GATA12    --------->At4g35610  <-----------HVH21
-YAB1 <---------ANAC58--------->ANAC58   <---------GLK1(1)<---------TOE1(2)     <---------ANAC58<---
 
ctcttccttccttggaatccaccacactccatttgcttcttctgagatctgatctctctcctaggtgatgcgctgcggagatggcgaatcttgtccccgg  2805500
                                              --------->ATERF1(1)
                                             --------->LBD16
                                             <---------ATERF1(1)
                                             ------>NtERF2
                                <---------bZIP60(1)
                                --------->bZIP60(1)
                                --------->bZIP60(2)
                                --------->TGA1a
 <-----------GT1                <---------TGA1a         <---------ARR14(2)  <---------YAB5
--NtERF2                        <---------O2--------->ATERF1(2)        --------->ANAC46
--->LBD16                       --------->O2<---------DEAR3(1)         --------->ANAC58
>NtERF2--------->ANAC58         ===========================================bZIP_DOF
-->ANAC46            ------->MYC3           <---------ATERF1(2)        --------->ANAC58
---DEAR3(1)          <-------MYC3           --------->DEAR3(1)     <-----------GT1                 -
-->LBD16 <---------GLK1(2)   --------->DEAR3(1)         --------->ARR14(2)  --------->ICU4       <--
--LBD16--------->ANAC58     --------->DEAR3(2)<------NtERF2     <----------DOF2             <-------
->ATERF1(1)       <---------ALFIN1         <---------LBD16  ------>ZmHOX2a(1)<---------ICU4 <-------
------ANAC46     <---------At4g35610       --------->ATERF1(1) <---------DOF5.7(1)         <--------
 
cgttttactcaagcttctccagcacatgaacaccgacgtcaaaatcgccggcgaacacaggtcctctcttttacaagtcatcagtattgttcccgcttta  2805600
                                                       --------->ANAC55(1)
                                                       --------->ANAC58
                                                       --------->bZIP60(1)
                                                       ==========================bZIP_DOF
                                                       --------->ANAC58
                                                       --------->ANAC46
                   <XXXXXXXXXXXXXXXXXXXXMIR1886.2      <---------bZIP60(1)
                   <---------KAN1                      <---------TGA1a
                  --------->RVE1(2)                    --------->O2
         --------->KAN1    <---------DOF5.7(1)         <---------O2
 <---------DEAR3(1)<---------ATHB12         --------->YAB5
<------NtERF2  --------->LBD16  --------->TOE2(3)      --------->TGA1a
-------->LBD16<---------HSFB2a(2)  ---------->DOF2  ----------->HVH21   <-----------GT1
-------LBD16  --------->HSFB2a(2)  ==============================bZIP_DOF ----------->RAV1(2)
---DOF2 <---------RVE1(2) <----------DOF2   --------->KAN1            <----------DOF2    --------->ATHB12
--DAG2 <---------At4g35610=======================================bZIP_DOF --------->ANAC55(2)  <----
-DOF5.7(1)   <---------LBD16 <---------CCA1(2)    ------>ZmHOX2a(1)  <---------DOF5.7(1)<---------YAB1
 
gccggaggtgagctattcccgaatcaaggcttttatctcaaagtctctgattcctctcacgccacttatgtctctttacctgatgaacacgatgatttga  2805700
                   <------MYB46(1)
                   <------MYB83                  <---------HSFB2a(1)
               <---------WOX13(2)                --------->HSFC1(2)
           <------ZmHOX2a(2)                     <---------KAN1
           --------->CCA1(2)                     --------->HSFB2a(1)
          <---------GATA12--------->ARR14(2)     <---------HSFC1(2)
          --------->GATA12<---------ARR14(2)    <---------ARR11(1)
          <---------ARR11(2)                    --------->ARR14(2)
          --------->ARR11(2)                    <---------GATA12
          <---------ARR11(3)                    --------->GATA12
          --------->AGP1  <---------ARR11(3)    --------->ARR11(2)
          --------->ARR11(3)                    <---------ARR14(2)                                 <
          --------->ARR14(2)                    <-----------ARR10                                ---
          --------->RVE1(2)                     ------->TEIL                                    <---
          <---------ARR14(2)  <-------TEIL     <---------ARR14(1)                            ------>ZmHOX2a(1)
   <----------ID1 --------->MYB59              <---------CCA1(2)  ------>ZmHOX2a(1)          =======
-----RVE1(2)   --------->WOX13(2)   <---------YAB1        ----------->RAV1(2) <---------ZAT6<-------
 
ttcttagcgacaagatccaattaggtcagtatattcatgttgatagagtcgaatcttcttcccctgttcctattcttcgtggtgttagacctgttcctgg  2805800
                                                                                      <---------YAB5
                                                                                      <-----------RAV1(1)
                                                                                    -------->HAHB4
                         <---------RVE1(2)                                          <---------ICU4
                         <---------ARR14(2)                                         --------->YAB1
                         --------->ARR11(3)                                        <---------YAB1
                         <---------ARR11(3)                                        <---------ATHB51
                         --------->ARR14(3)                                       --------->AHL20(3)
                         <---------ARR14(3)                                       <---------AHL20(3)
                    ------>ZmHOX2a(1)                                            --------->YAB1
            <------MYB46(1)                                                   --------->YAB5
            <------MYB83 --------->ARR14(2)                                   --------->YAB1
--------->KAN1    ------>ZmHOX2a(2)                <---------GLK1(1)         <---------YAB1
---------YAB5   <---------RVE1(2)               <---------TOE2(3)   ----------->GT1--------->ICU4
------>ETT(2)   --------->ARR11(3)    <---------ATHB12        ----------->HVH21 <---------YAB1
-----P     <---------AtMYB61     <---------At4g35610        --------->YAB1 <---------ICU4       ----
=========================HOX2a_HOX2a  <---------YAB5        --------->YAB5 --------->YAB1<---------AtMYB61
--ANAC46<-----------RAV1(1)  <---------REM1(1)--------->STY1(1)--------->YAB5----------->GT1<-------
 
tagacatccttgtgttggtgatcctgaagatattgtagctactcattcactagggtttctcagtgatgacaaggttaaaaatgataataatggtggtgtt  2805900
<- Previous    Next ->

AGI:  At1g08760.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G13370.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN75715.1); contains InterPro domain Protein of unknown function DUF936, plant (InterPro:IPR010341)
Range:  from: 2805374    to: 2808624    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version