AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                               -----
                                                                                           ---------
                       <---------ALFIN1                                                    <--------
              <---------ALFIN1                                            <---------HSFB2a(2)<------
       <----------DOF2<---------ZAT18                              <----------DOF2       <----------DOF2
       <---------DOF5.7(1)      <----------DOF2          <---------DOF5.7(1)   <---------WOX13(2)
      <---------DOF5.7(1)      <---------ANAC58          <------NtERF2    --------->HSFB2a(2)<------
      <---------DAG2  --------->ZAT18           --------->ZAT14   <---------DOF5.7(1)   <---------ANAC58
<-----------RAV1(1)  <-----------------AGL1--------->LBD16<---------DOF5.7(1)  --------->WOX13(2) --
--------AtLEC2--------->ANAC46 <---------ANAC58 <---------ZAT14  <---------DOF5.7(1)    <---------ANAC58
 
tgcatgttgccttttccacacattgcccactctggctttagtcttccccagttctctggccccttctctcctttcttctcgtagttaaactgcgtttcgt  2513100
      --------->AHL12(3)
      --------->AHL20(3)
      <---------AHL25(1)
      <---------AHL20(3)
      <---------AHL25(2)
      <---------AHL20(2)
      <---------AHL12(3)
    --------->AHL12(2)
    --------->AHL12(3)
    <---------AHL12(3)                                 --------->YAB1
    <---------AHL25(2)                                 <---------ICU4
    <---------AHL20(2)                     --------->WOX13(2)      --------->DOF5.7(1)       -------
----->ID1                      --------->AHL20(2)     <---------YAB5                 --------->RVE1(2)
>ARR11(2)                      <---------AHL25(1)     --------->ICU4              --------->YAB1
-ARR11(2)                      <---------AHL12(3)     <---------YAB1        --------->HSFB2a(2)
---ANAC58                      --------->AHL25(2)    --------->WOX13(2) <---------ANAC58 --------->WOX13(2)
---ANAC58                      <---------AHL25(2)    <---------WOX13(2) <---------ANAC58 <---------WOX13(2)
---->ZmHOX2a(1)        ----------->GT1     <---------WOX13(2)    ---------->DOF2 <---------YAB5
 
cctctatattttttttggttatacacgagttaaaaaaaatgtgtttcattaagtctaattataacttataaagaggcttatggaatcatatcaattgaaa  2513200
                                                ------>MYB83
                                  <-----------GT1
                                  --------->MYB52(1)
                                <---------KAN1  ------>MYB46(1)        --------->ANAC46
                           --------->HSFB2a(2)<---------MYB59     --------->ZAT14
                       <---------ANAC58 <---------At4g35610       <---------ZAT18
                       <---------ANAC58 --------->ZAT2       ------>ZmHOX2a(2)
                  --------->DOF5.7(1)   --------->At4g35610<---------GATA12                        <
                 --------->DOF5.7(1)   <-----------ARR10   --------->ARR11(3)               XXXXXXXX
 ----------->GT1--------->DOF5.7(1)  ------->GAMYB         <---------ARR11(3)     <---------YAB1 ---
--->DOF2        ---------->DOF2--------->WOX13(2)          --------->GATA12     --------->YAB1  ----
 
gaagttgttaaaaaaaaaaaaaagaggcttatggaattaacggagcttaccaacttctccatgatctggtgaactcgaaacaattgtaatagagatgaag  2513300
                                                                            --------->AHL12(1)
                                                                            <---------AHL12(1)
                                                                           --------->AHL12(1)
                                                                           <---------AHL12(2)
                                                                           --------->AHL12(3)
                                                                           <---------AHL12(1)
                                                                           <---------AHL25(3)
                                                                           <---------AHL25(2)
                                                                           --------->AHL25(2)
                                                                           <---------AHL25(1)
    ---------->DOF2                                                        --------->AHL25(1)
    --------->DOF5.7(1)                                                   --------->AHL25(1)
 <------ZmHOX2a(1)        --------->ARR11(3)                              --------->AHL12(2)       <
<----------ID1            <---------ARR14(2)     --------->ARR11(3)       --------->AHL20(2)      --
---------TOE2(3)          <---------ARR11(3)     <---------ARR11(3)       --------->AHL25(3)  <-----
XXXXXXXXXXXX>MIR854A-E    --------->ARR14(2)    <---------CCA1(2)         <---------AHL25(2) -------
------>CCA1(2)   --------->WOX13(2)  <---------ANAC58            --------->CCA1(2)         xxxxxxxxx
----->ARR11(3)   <---------WOX13(2)  <---------ANAC58 <---------LBD16     <---------AHL12(3) <------
 
ataaggaaaaagacatagccaattgatggtatcttcattttcttgtgctatatatcttggggagagagatagaagaaaaaaattcaaattttggttttat  2513400
                                                    ------------>CBF
<----------DOF2                                     <---------ATHB12       <-----------TBP
---------DOF5.7(1)                                *TSS                    <----------DOF2
---->ZmHOX2a(1)                                   --------->WOX13(1)     <---------DOF5.7(1)
------GT1     <---------YAB1                  --------->YAB1            ------>ZmHOX2a(1)
-->KAN1     --------->KAN1                   <---------YAB1         <-----------GT1
xxxxxxx>smallRNA(i) <---------YAB1    --------->ARR11(3)           --------->KAN1            -------
-----GT1  <---------DOF5.7(1)         <---------ARR11(3)           <-----------GT1  <---------DOF5.7(1)
 
cctcttttatagctcttattcttatgaaacaacttcaaggagatgttgatcataaatcaattctcttgttttatcctcttttatagctcttattcaagtt  2513500
                                                                                                   <
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                             -------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           ---------
                                                                                          --------->AHL20(2)
                                                                                          --------->AHL25(3)
                                                                                         --------->AHL12(2)
                                                                                       <---------AHL12(3)
                                                                                       <---------AHL12(1)
                                                                                       --------->AHL25(1)
                                                                                       --------->AHL12(3)
                                                                                       <---------AHL20(2)
                                                                                       --------->AHL12(1)
                                                                                      <---------AHL12(1)
                                                                                      --------->AHL25(1)
                                                                                      --------->AHL12(1)
                                                                                      --------->AHL25(2)
                                                                                      --------->AHL20(1)
                                                                                      <---------AHL25(2)
                                                                                      <---------AHL20(3)
          ------->TEIL            --------->WOX13(2)                                  --------->AHL20(3)
       <---------ANAC58           <---------WOX13(2)                                  <---------ARR11(3)
       <---------ANAC58           <---------AHL12(2)                                  --------->ARR11(3)
       <---------ANAC55(2)        --------->AHL12(2)        <----------DOF2<---------WOX13(2)<------
       --------->ANAC55(2)    <---------DOF5.7(1)     <---------YAB1  ----------->GT1 <---------AHL20(1)
       <---------ANAC55(1)    --------->TOE2(3)   <----------DOF2    <---------TOE1(3)--------->AHL20(2)
     <-----------GT1          --------->TOE1(3)<-----------GT1       <---------TOE2(3)<---------AHL20(2)
-->WOX13(2)                <-----------GT1  --------->WOX13(2)       --------->MYB59  --------->AHL25(3)
 
aacaaattttacgtgccttagctatagttttcaccttaattttctctaattttctttatgtttctttgtttttaggtaaattgtatcaatatatttaatt  2513600
       --------->DOF5.7(1)
      ---------->DOF2
 ---------->DOF2
---------AHL20(2)
-----AHL25(1)
-----AHL20(3)
---->AHL25(1)
-----AHL12(3)
---->AHL20(2)
-----AHL12(1)
---->YAB1
---->AHL12(1)
---->AHL20(3)                                                <---------WOX13(2)
-----AHL20(2)                                                <---------AHL12(2)
---->AHL12(3)                                                --------->WOX13(2)
----YAB5                                                    <---------AHL20(2)
-->WOX13(2)                                                 --------->AHL20(3)
-AHL12(3)                                                   --------->AHL25(1)
>AHL20(2)                                                  <---------AHL25(1)                     <-
>AHL12(3)                                                  <---------AHL20(2)                     --
>AHL20(3)                                                  --------->AHL20(2)                     <-
-AHL20(2)                                                  --------->AHL25(3)                     <-
-AHL25(1)                                                --------->TOE2(3)                      <---
-AHL25(3)              <---------PCF2                   --------->YAB5 <---------RVE1(2)        <---
-AHL20(3)         <-----------RAV1(1)                   <--------HAHB4--------->ATHB12          ----
-AHL12(1)       <----------DOF2                        <------ZmHOX2a(2)                        ----
>AHL12(1)    --------->ARR11(3)             <---------ANAC46<---------AHL20(3)                 <----
>AHL25(1)    <---------ARR11(3)            <------ZmHOX2a(1)--------->AHL20(2)                 <----
>AHL25(3)   --------->GLK1(1)              ===================HOX2a_HOX2a                      -----
---WOX13(2) <---------GLK1(1)  ----------->GT1 <---------ZAT14       <---------YAB5          <------
 
atataaaagaaaaggaaatctttgtgggactcaccagttaaatggaggagtgtattggatcattaatttagagtgatttgagtttttatgagttttgata  2513700
                                                                                   <---------AHL20(2)
                                                                                   --------->AHL12(3)
                                                                                   <---------AHL12(3)
                                                                                   --------->AHL20(3)
                                                                                   <---------AHL20(3)
                                                                             ------>ZmHOX2a(2)
                                     <---------AHL12(2)                    --------->ARR11(3)
                                     <---------YAB1                        <---------AGP1
                                    --------->AHL20(3)                     --------->ARR14(2)
                                    <---------AHL25(3)                     <---------ARR11(3)
--------AHL25(1)                    --------->AHL25(1)                     --------->ARR11(2)
------->AHL20(3)                    <---------AHL25(1)                     --------->GATA12
--------AHL20(2)                    <---------AHL20(3)                     <---------RVE1(2)
--------AHL20(3)                    --------->AHL12(3)                     <---------ARR11(2)
------AHL12(2)                     --------->YAB1<---------GATA12          <---------ARR14(2)
------AHL12(3)                    <---------YAB1 <-----------ARR10         <---------GATA12
----->AHL12(2)                 <---------YAB1    --------->GATA12    --------->GATA12            <--
----->AHL12(3)               ----------->GT1     --------->RVE1(2)   <---------ARR14(2)          ---
-----AHL12(1)          <------ZmHOX2a(1)        <---------CCA1(2)    <---------RVE1(2)           <--
-----AHL25(2)        --------->MYB59--------->AHL20(2)               <---------GATA12    <---------WOX13(2)
---->AHL12(1)     <---------WOX13(2)<---------AHL20(2)               --------->ARR14(2)  --------->WOX13(2)
---RVE1(2)        --------->WOX13(2)<---------AHL25(2) --------->At4g35610<---------CCA1(2)      ---
 
tttttttggtgaattttgttgaattaggaaatttgttattaaaattctctcaaatctcatctaaaactatgggatttggatcttatatttttaactaaga  2513800
                                                                             --------->YAB5
                                                                             <--------ATHB1
                                                                             --------->KAN1
         --------->YAB1                                                      <---------ICU4
   --------->LBD16              --------->AHL20(2)                          <---------AHL25(1)
  <---------HSFB2a(2)      <---------TOE1(2)                 --------->ZAT6 --------->AHL25(3)
  --------->HSFB2a(2)   ------>ZmHOX2a(2)           <---------TOE2(3)       <---------KAN1
  <---------HSFC1(1)   <---------------AtSPL8       --------->DAG2          <---------AHL12(1)
  --------->HSFC1(1)   --------------->AtSPL8      ---------->DOF2          --------->AHL12(1)
-------HSFB2a(1)       --------------->AtSPL3     <---------ATHB12      --------->LBD16
------>HSFB2a(1)      <---------RVE1(2)      <-----------------AGL1    --------->HSFB2a(2)
-------HSFC1(2)  <---------RVE1(2)           <-----------------AG      <---------HSFB2a(2)      ----
------>HSFC1(2)  <---------GATA12      <-----------GT1     --------->YAB1 --------->YAB1        <---
 
aatttccagaaataacaatggatttgatcgtacattttaaaattactaatccaataaggcaataacacttgattccagaataattccacttcaaaatttc  2513900
                                           --------->AHL12(3)
                                           <---------AHL20(2)
                                           <---------AHL20(1)
                                           --------->AHL20(2)
                                           --------->AHL20(1)
                                          --------->AHL25(3)
                                          --------->AHL25(2)
                                          <---------AHL25(1)
                                          --------->AHL25(1)
                                          <---------AHL12(3)
                                          --------->AHL20(2)
                                          --------->AHL12(3)
                                          <---------AHL25(2)
                                         <---------AHL12(2)
                              <---------AHL20(3)
                              --------->AHL20(3)
                              --------->AHL25(1)
                              <---------AHL20(2)
                            --------->AHL20(3)
                            <---------AHL20(3)
                            --------->AHL12(2)
                          --------->AHL25(3)
               --------->ATHB12          --------->AHL12(2)
               --------->AHL25(1)       --------->AHL20(3)
               <---------AHL25(1)       <---------AHL20(3)
               <---------AHL25(3)       <---------AHL25(2)
               <---------AHL20(2)       --------->AHL25(2)
               --------->AHL20(2)       --------->AHL12(1)
               --------->ATHB51        <---------AHL12(2)
               --------->AHL12(1)      --------->AHL12(2)
              --------->AHL25(3)      --------->AHL12(3)
              --------->ICU4--------->AHL12(3)
              <---------YAB5--------->AHL25(2)
             --------->AHL12(2)       <---------AHL20(2)
             <---------WOX13(2)       <---------AHL12(3)
             <---------AHL12(2)       <---------AHL25(1)
             --------->WOX13(2)       --------->AHL20(3)
            --------->AHL12(2)--------->AHL25(2)      <---------AHL20(2)
           --------->AHL25(3) <---------AHL25(1)     --------->AHL20(2)
           --------->AHL20(2) <---------AHL25(3)<---------AHL20(2)
           <---------AHL25(1) <---------AHL25(2)--------->AHL20(2)
           <---------AHL12(1) --------->AHL12(1)--------->AHL12(3)
           <---------AHL20(2) --------->AHL20(2)--------->AHL25(1)
           --------->AHL12(1) <---------AHL12(1)<---------AHL12(3)                                --
           --------->AHL25(1)--------->AHL12(2) <---------AHL25(1)                              <---
          <---------WOX13(1)<---------AHL25(2)  <---------AHL20(3)                           <------
        --------->ATHB12  <---------YAB1<---------AHL12(1)                                 ---------
        --------->YAB5   --------->AHL20(3)--------->AHL25(1)                              ---------
       --------->ICU4    --------->AHL25(2)<---------AHL12(3)                              <--------HAHB4
       <---------YAB1    --------->AHL20(2)<---------AHL25(3)                              <--------
       <---------YAB5    <---------AHL20(2)--------->AHL25(3)                             <---------YAB5
     <---------ICU4      <---------AHL20(3)<---------AHL25(2)                             <---------ATHB12
     --------->YAB1      <---------AHL25(2)<---------AHL25(1)                             <---------YAB1
    --------->ICU4       <---------AHL20(1)--------->AHL25(2)                          <---------AHL20(2)
    <---------ATHB51    --------->YAB1<---------AHL25(2)                               --------->AHL25(1)
  --------->YAB5       <---------YAB1 <---------AHL20(3)                               --------->AHL20(2)
----->HSFB2a(2)<---------ICU4<---------AHL12(2) --------->AHL20(3)  --------->KAN1    --------->AHL20(2)
------HSFB2a(2)<---------AHL12(1)    --------->AHL20(2)     ------->TEIL    --------->YAB1--------->ICU4
 
caaaacaattatgattaattatttgtattataattttttataaaattttatttatataaaatgaacgcttcacattcgataagaacacatttaatcatta  2514000
<- Previous    Next ->

AGI:  At1g08065.1   
Description:  carbonate dehydratase/ zinc ion binding. similar to carbonic anhydrase family protein [Arabidopsis thaliana] (TAIR:AT1G08080.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21870.1); contains InterPro domain Carbonic anhydrase, eukaryotic; (InterPro:IPR001148)
Range:  from: 2511644    to: 2513451    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version