AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                     <------ZmHOX2a(2)           ---
                                                                     --------->CCA1(2)           ---
                                                                    --------->RVE1(2)            ---
                                                                    --------->AGP1               <--
                                                                    --------->ARR11(3)           <--
                                  ------>NtERF2                     <---------ARR14(2)           <--
                                 --------->ANAC46                   <---------AGP1               ---
                                 --------->LBD16                    --------->ARR14(2)           <--
            <----------DOF2      <---------ETT(1)                   <---------GATA12            <---
            <---------DOF5.7(1) <---------HSFB2a(2)                 <---------ARR11(3)          <---
         <---------ATHB12   <---------DOF5.7(1)       <---------ANAC58                          <---
        --------->ARR14(2) ------>ZmHOX2a(1)          --------->ANAC55(2)----------->HVH21      ----
 <---------DOF5.7(1)  <---------DOF5.7(1)             <---------ANAC58------>ZmHOX2a(2)         ----
 <----------DOF2      <----------DOF2      <---------ZAT14        ----------->ARR10             ----
<---------DOF5.7(1)  <---------DOF5.7(1)   --------->ZAT14      ---------->DOF2                -----
<---------DAG2       <---------DAG2 <---------bZIP60(1)      --------->ANAC58                 <-----
--->ZmHOX2a(1)    ------>ZmHOX2a(1) --------->bZIP60(1)      --------->ANAC58   --------->REM1(2)---
------ALFIN1------>ZmHOX2a(1)   --------->HSFB2a(2) <-----------GT1 --------->GATA12          ------
 
ctccctttcccaatccttttcctccctttcctcttcccgacatcacttcacagttttacttgatacccaaagatctgtgactgtgaagaacagaagaaaa  2421800
          --------->YAB1
          ----------->GT1
------->AHL12(1)
--------AHL25(3)
--------AHL12(1)
------>AHL25(3)
------>AHL12(1)
------>AHL12(3)                 <---------GLK1(1)
-------AHL12(2)                 --------->GLK1(1)
-------AHL12(1)                <---------GATA12
-------AHL25(2)                <---------GLK1(2)
------>AHL25(1)                <---------ARR11(3)
-------AHL25(1)          --------->ANAC58
------AHL12(2)           --------->ANAC58
------AHL25(2)        --------->ARR14(2)
------AHL12(3)        <---------ARR11(2)            --------->WOX13(2)                         <----
----->AHL12(3)        <---------GLK1(2)        --------->WOX13(2)                          <--------
----->AHL12(2)        <---------ARR14(2)    <---------ATHB12                               <--------
----->AHL25(2)        --------->ARR11(2)  --------->WOX13(1)          <-----------GT1      <--------
---->AHL12(2)    --------->MYB52(1)     <---------ATHB12    <------ZmHOX2a(2)              ---------
----AHL12(1)    ------->GAMYB  --------->GATA12<---------WOX13(2)    ---------->DOF2       ---------
------>AHL25(2)--------->MYB46(3)      --------->RVE1(2)   <---------GATA12              -----------
--->AHL12(1)   <---------MYB52(2)  ----------------->AG <---------TOE2(3)            >>>>>>>>>TBF1
 
attattcagtgaatggtaacgaacagaaacgctagatttccaaatcaatcaattgaattgacgatcgaacaataaaccagatggagaagaagaagatact  2421900
                                                                                    --------->LBD16
                                                                                   <---------ANAC58
                                                                                   <---------ANAC55(2)
                                                                                   <---------ANAC46
                                       *TSS                                        <---------ANAC58
                                     --------->CCA1(2)                          <---------RVE1(2)
                                     --------->GLK1(1)                          <---------GATA12
                                     <---------KAN1                             --------->GATA12
                                    <---------ARR11(2)                          <---------ARR11(2)
    --------->ATHB12                <---------RVE1(2)                          --------->KAN1
   <---------YAB1                <---------ANAC46                             --------->WRKY12
------DOF2                      <---------LBD16                               ----------->ARR10
-ARR14(2)                     ----------->HVH21                               --------->WRKY38(1)
-ARR11(3)             --------->WOX13(2)          <---------WOX13(2)        <-------GAMYB<---------RVE1(2)
-ARR11(2)             <---------WOX13(2)  <---------bZIP60(2)              <---------ANAC46
>ARR14(2)          <------ZmHOX2a(2)--------->ARR14(2)           ----------->TBP--------->ARR11(2)--
>ARR11(3)         --------->RVE1(2) --------->ARR11(2)          --------->AHL20(1) <---------ANAC55(1)
>ARR10           <------ZmHOX2a(1)  <---------ARR14(2)          <---------AHL20(1)------>ZmHOX2a(2)
 
tttaagatgatttggagagaggatcaattgaatttgacggatatgaagtggctaactaatgtcttaatatataaaactgcgttgatccgtgtgatttttc  2422000
                                                            <---------O2                --------->ARR11(3)
                                                            <---------ANAC58    --------->WOX13(2)
                                                            --------->O2      <---------AHL25(1)
                                                            ===================================bZIP_DOF
                                                            <---------TGA1a   <---------AHL25(3)
                                                            <---------bZIP60(2) <---------WOX13(2)
                                                            <---------ANAC58  --------->AHL25(1)
                                                            <---------ANAC46  <---------AHL12(3)
                                                           ----------->STF1   <---------AHL20(2)
                                                          <---------TGA2(2)   --------->AHL20(2)
                                                    <---------ARR11(2)       --------->AHL25(2)
                                                    <---------ARR14(2)       --------->AHL25(1)
                                                    --------->ARR14(2)       <---------AHL25(1)
                                                    <---------GATA12         <---------AHL20(1)
                                               --------->MYB52(1)            --------->AHL20(2)
                                              ----------->HVH21   <---------WOX13(1)    <---------ARR11(3)
                       --------->YAB1       --------->ANAC55(2)  <---------ANAC58   ---------->DOF2
                       --------->YAB5       <---------ANAC55(2)  <---------ANAC58<---------WOX13(1)
                  ------------>CBF   <---------DOF5.7(2) ----------->TGA1    --------->AHL20(3)
                  ------>ZmHOX2a(2)--------->DOF5.7(2)   ----------->HVH21   <---------AHL25(2)
        --------->YAB5 ----------->GT1 --------->ZAT6<------ZmHOX2a(2)       --------->AHL25(3)
      <---------MYB52(1)          --------->TOE2(3) --------->ARR11(2)       <---------AHL20(2)
   --------->MYB46(3) <---------ATHB12------------>CBF------>ZmHOX2a(2)    <---------WOX13(2)
------->RVE1(2) <---------GATA12  --------->TOE1(3) --------->GATA12       --------->WOX13(2)   <---
 
atatcaaccgttgattactgatccaatggttatacatcgttaacaatacttgacggatcgatgacgtggattgctcccaatttaattgaaagatgttgtt  2422100
                                              <-----------RAV1(1)
                                              --------->ALFIN1
                                     <---------AHL12(2)
                                    --------->AHL20(2)
                                    <---------AHL20(2)
                                    <---------AHL25(3)
                                    --------->AHL25(2)
                                    --------->ATHB51                                          ------
                                    <--------ATHB1 <---------ANAC46                           <-----
                                    <---------ICU4<---------MYB46(3)                         <------
                                    <---------AHL25(2)                                       <------
                                    <---------AHL12(1)                                    <---------
                                    --------->AHL12(1)                                    ----------
                                   <---------ATHB12<------MYB83                          -----------
                                   <---------ATHB51<------MYB46(1)                       -----------
                                   --------->ICU4 --------->MYB59   ---------->DOF2      -----------
------AHL20(2)                     --------->AHL25(3) <---------DOF5.7(1)          ----------->RAV1(2)
 
ttattgaaaaacaaaacaaaaacagcattcgtcttccaataatttgcaagtgttgggtcttattaggccttaaaagagaaaatgaaacctggcccaataa  2422200
  --------->YAB5
 ------------>CBF
--------->RVE1(2)                             --------->ANAC46
--->YAB1                                <---------ANAC58
---ATHB1                                <---------ANAC58
---ATHB12                            *TSS    <---------LBD16
---ATHB51--------->MYB52(1)          <---------ARR11(2)    <---------YAB1
------AGL15                          --------->ARR11(2)  --------->KAN1
----->AGL15               <---------ZAT18  --------->ARR11(2) <---------HSFB2a(2)
------>AGL2               --------->ZAT18  <---------ARR11(2) <---------LBD16
------>AGL3   --------->AGP1    ---------->DOF2--------->LBD16--------->HSFB2a(2)
->CBF --------->YAB1 <------------CBF<-----------GT1    <---------MYB52(1)                      <---
 
tagtatcaatactaacagagctagtattgggccctaaaagtttccgtctccgtaaacctgttattctcggagaaacgttgagagagggttttccattctc  2422300
                ----------->HVH21
               --------->LBD16
              <---------ANAC46
             <------NtERF2
            ------>NtERF2                                                                     ------
           --------->DEAR3(1)                                                                <------ZmHOX2a(2)
           <---------DEAR3(1)                                                               --------
          --------->ATERF1(1)                                                               --------
         <---------ATERF1(1)                                                                <-------
         <-----------HVH21                                                           --------->REM1(2)
        --------->DEAR3(1)                                                           <---------ZAT18
    ----------->HVH21                                                   --------->KAN1 <---------ZAT14
    <------NtERF2                                        --------->KAN1<---------GATA12<---------REM1(2)
    --------->ATERF1(1)                                  <---------AHL20(2)          <---------ZAT14
   <---------ATERF1(1)                                 --------->AHL12(2)            --------->ZAT14
   <---------RAP2.6(3)                      <-----------HVH21  =====================================HOX2a_HOX2a
   <-----------HVH21                        <---------MYB52(1) ------>ZmHOX2a(1)   --------------->AtSPL8
  --------->ANAC46                         --------->LBD16     <---------At4g35610<---------ANAC46
  --------->RAP2.6(2)         ------>ZmHOX2a(1)     <---------YAB1     --------->GATA12--------->ZAT18
--------RAV1(1)--------->At5g28300       <---------LBD16--------->AHL25(3)   <----------DOF2--------
 
tgtggccgtcaccgtcgccgtgaaatagctctcctctctctatctccggtgagttcttatttattcctctgcgagatgtgcttttctgtgtacacgatct  2422400
                                <----------DOF2
                           --------->SPL7(1)
                          <-----------GT1
                       <---------------AtSPL3
                       --------------->AtSPL8
                       <---------------AtSPL8
                    <---------AHL25(2)
                    --------->AHL25(2)
                    --------->AHL20(1)
                    <---------AHL12(1)
                    <---------AHL25(3)
                    <---------AHL20(3)
                    --------->AHL12(1)
                    --------->ARR11(3)
                   --------->AHL12(3)
                   --------->AHL12(2)
                   <---------AHL12(1)
                   <---------AHL12(3)
                   <---------AHL25(1)
                   --------->AHL25(3)
                   --------->AHL25(1)          <---------At5g28300
     <---------LBD16<---------AHL20(1)        <-----------GT1                       <---------MYB46(3)
>ZmHOX2a(2)        --------->AHL12(1)    <---------YAB5                            <---------WOX13(1)
->RVE1(2)         <---------AHL25(2)   <-----------GT1                          <---------YAB1
->ARR11(3)        --------->AHL25(3)<---------WOX13(2)                      <----------DOF2  <------
--ARR11(3)        --------->AHL12(1)--------->WOX13(2)                     <---------DOF5.7(1)------
->GATA12          <---------AHL12(1)--------->TOE2(3)                 <---------GLK1(1)<---------MYB46(3)
 
ctcacttcttcggaagcctgaaatattttgtacgactttcattaaccatttaccattttgttatccaatctcgatttctctttctgattgttgttgatga  2422500
                                                                                --------->ZAT2
                                                                                <------NtERF2
                                                                                --------->ATERF1(1)
                                                                                <---------ZAT2
                                                                                --------->At4g35610
                                                                                <-------GAMYB
                                                                                <---------At4g35610
                                                                               <---------ATERF1(1)
                                                                               <---------RRTF1(1)
                                                                               <---------MYB46(3)
                                                                               <---------RAP2.3(1)
                                                                               ------>NtERF2
                                                                               <---------ERF1
                                                                              <---------RAP2.6(2)
                                                                              <---------RAP2.3(3)
                                                                              <---------RAP2.3(2)
                                                                              <---------DEAR3(1)
                                                                              --------->ATERF1(2)
                                                                              <---------ATERF1(2)
                                                                              <---------DREB2C(2)
                                                                       --------->GLK1(2)       <----
                                                                     --------->KAN1<------NtERF2
                                                             <---------LBD16  <---------ANAC46------
                                                   --------->ANAC46 ----------->ARR10         <-----
                                                   --------->ANAC58<------ZmHOX2a(1)        <------NtERF2
                --------->RVE1(2)          --------->YAB5    --------->ETT(1) <---------RRTF1(3)
               --------->At4g35610    <---------AHL20(2)     <---------ANAC46 <---------RRTF1(2)
    <---------AHL12(2)           ---------->ID1<---------ANAC58    =================================
  --------->AHL20(2)            <-------GAMYB  <---------ANAC58<------NtERF2 --------->RAP2.6(3)----
<---------GLK1(2)  ---------->DOF2----------->GT1  --------->ANAC55(2)<---------ARR14(2)   ------>NtERF2
---YAB1       --------->ANAC58 --------->MYB52(2)  --------->ANAC58=================================
--->YAB5      --------->ANAC58 <---------MYB46(3)  <---------ANAC55(2)<---------GLK1(2)<---------DEAR3(1)
 
tcagattatataactgcaagctcaaaggaattgtttgttgttaaaatgtttcttacgcgatttgtcgggaggagattcttggcggctgcatcggcgcgat  2422600
                   --------->ZAT2
                   <---------ZAT2
                <---------At4g35610
                --------->At4g35610            --------->ARR14(2)
               ================RAV             <---------ARR14(2)
             --------->At4g35610               --------->ARR11(2)
            ===================RAV             <---------ARR11(2)
            ----------->RAV1(1)                --------->RVE1(2)
       ---------->DOF2                         --------->GATA12
       <---------ZAT14                         <---------GATA12
       --------->ZAT14         <---------ARR14(2)
     --------->ANAC46 ------>NtERF2       ------>NtERF2
  <---------ZAT14  --------->At4g35610    ----------->RAV1(1)
  --------->ZAT14  <---------At4g35610 ------>NtERF2
  <---------ZAT18  ----------->RAV1(2)--------->ANAC46
  --------->ZAT18<-----------RAV1(2)  --------->ANAC58
--ZmHOX2a(2)=================RAV      --------->RAP2.6(2)                    --------->At4g35610
--->GATA12<---------At4g35610  --------->ARR14(2)                            <---------At4g35610
----GATA12--------->At4g35610  <---------ARR11(2)                        ----------->RAV1(1)
===HOX2a_HOX2a ----------->RAV1(1)    --------->ANAC58       --------->ARR11(3)
-->ZmHOX2a(2)<---------At4g35610     --------->SPL7(1)       <---------ARR11(3)--------->ANAC58
==HOX2a_HOX2a--------->ZAT2   --------->YAB5--------->MYB46(3)  <----------DOF2--------->ANAC58<----
 
cggagtccactacagcagcagcagctgcctcgacgattcggacgccaacaaatccactcgaagagttctttgagttcgacagaagccaagacgaagataa  2422700
<- Previous    Next ->

AGI:  At1g07820.1   
Description:  histone H4. Identical to Histone H4 [Arabidopsis Thaliana] (GB:P59259;GB:P02308); similar to histone H4 [Arabidopsis thaliana] (TAIR:AT5G59690.1); similar to histone H4 [Arabidopsis thaliana] (TAIR:AT5G59970.1); similar to histone H4 [Arabidopsis thaliana] (TAIR:AT3G53730.1); similar to hypothetical protein OsJ_028319 [Oryza sativa (japonica cultivar-group)] (GB:EAZ44836.1); similar to histone 4 [Elaeis guineensis] (GB:ABD62753.1); similar to histone H4 [Hyacinthus orientalis] (GB:AAT08725.1); contains InterPro domain Histone H4; (InterPro:IPR001951); contains InterPro domain Histone-fold; (InterPro:IPR009072); contains InterPro domain Histon
Range:  from: 2421215    to: 2421940    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g07830.1   
Description:  ribosomal protein L29 family protein. similar to unknown [Populus trichocarpa] (GB:ABK93723.1); contains InterPro domain Ribosomal protein L47, mitochondrial; (InterPro:IPR010729); contains InterPro domain Ribosomal protein L29; (InterPro:IPR001854)
Range:  from: 2422238    to: 2423652    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version