AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  <---------SPL7(1)
                                 --------->ANAC58
                --------->DOF5.7(1)
              ---------->DOF2    --------->HSFB2a(1)
         <---------KAN1          <---------HSFB2a(1)        <---------GATA12       <---------ICU4
        --------->RVE1(2)        --------->ANAC58          --------->At4g35610     --------->YAB5
        --------->GLK1(2)       --------------->AtSPL3     <---------At4g35610     --------->YAB1
        --------->ARR14(2)      <---------------AtSPL3   <-----------RAV1(2)      <---------KAN1
        <---------ARR14(2)      <---------------AtSPL8  --------->LBD16           <---------ATHB12
       <---------GLK1(2) <---------YAB5                 <---------At4g35610       <---------YAB5
  --------->MYB52(1)  <---------KAN1                  <---------LBD16 <----------DOF2<---------YAB1
--------->RAP2.6(2)  <---------KAN4(2)----------->HVH21<---------ANAC46   --------->ZAT6
 
aagccgaacagaatctgtaaagggagtattcatggaacgtactgacaactacagcattccgcagatggagaggctttacactcgaatcatgaagggtgtt  1796400
                                   --------->YAB1
                                 --------->AHL12(2)
                                 <---------AHL20(3)
                                 <---------AHL12(2)
                                 --------->AHL20(3)
                               <---------YAB1                         --------->GLK1(1)
                             --------->YAB5                           <---------ARR14(2)
                             --------->YAB1                           --------->ARR14(2)
                            <---------YAB1                            <---------GLK1(1)
                          --------->YAB5                          --------->ETT(1)                --
                         <---------YAB1    <---------YAB5        ---------->ID1                   <-
                         --------->ICU4--------->TOE2(3)  --------->ARR11(3)                      --
             --------->DOF5.7(1)--------->YAB1            <---------RVE1(2)                <--------
           ---------->DOF2--------->YAB1------>ZmHOX2a(1) <---------ARR11(3)       <-----------RAV1(2)
   --------->GLK1(2)<---------ANAC46  --------->YAB1    <---------TOE2(3)        <-----------HVH21--
 
cttgagactctggacaaagggcttcgtgatgatgataataatcctaagcattcaattttgagatttttgtcggaattcgcacagcatcaggcgaatttct  1796500
                                                                   --------->AHL25(1)
                                                                   <---------AHL20(2)
                                                                   <---------AHL25(2)            <--
                                                                   <---------AHL12(3)     --------->ARR11(2)
                              <------MYB46(1)                      --------->AHL12(2)     <---------ARR14(2)
              --------->ARR14(2)                                  --------->AHL12(1)      --------->ARR14(2)
              --------->ARR11(2)                                  --------->AHL25(3)      <---------GLK1(2)
         <-----------------AGL1                                  <---------CCA1(1)        <---------ARR11(2)
     <---------AHL12(1)    --------->ARR11(2)                    <---------RVE1(1)      --------->LBD16
    --------->WOX13(2)     <---------ARR11(2)                   --------->ARR11(3)    <---------LBD16
----->TEIL   <---------CCA1(2)<------MYB83                      <---------ARR11(3)  <---------ARR14(2)
--------GATA12<---------ARR11(2)                       <----------ID1               --------->GATA12
------->GATA12<---------ARR14(2)                   ---------->DOF2<---------AHL12(1)<---------GATA12
-KAN1--------->AHL12(1)   <------ZmHOX2a(1)      <---------KAN1 <---------GLK1(2)   --------->ARR14(2)
------->RVE1(2)   <-----------HVH21     <------ZmHOX2a(1)   ---------->DOF2     <-----------GT1 <---
 
gaatctaaattttctcatatcggtcactaggataggtttgctaggagaaagaatgaaaggaacaaaagattttttttggttttttaaaatccggattctt  1796600
                                              <---------ARR14(2)
                                              --------->ARR14(2)                           ---------
                                              --------->ARR11(2)                          --------->DAG2
                                              <---------GLK1(2)                           --------->DOF5.7(1)
                                             <------ZmHOX2a(1)                  --------->TOE1(3)
         --------->DAG2   ----------->GT1   <------MYB46(1)                     --------->TOE2(3)
         --------->DOF5.7(1)                ----------->ARR10            <----------DOF2 --------->DOF5.7(1)
        ---------->DOF2  --------->DAG2   <--------P ----------->GT1    <---------DOF5.7(1)---------
--------DOF2             --------->DOF5.7(1)<------MYB83  <---------WOX13(2)    --------->YAB1
------DOF5.7(1)        ---------->DOF2   <---------MYB52(1)           ------->TEIL       ---------->DOF2
 
cttttgactgaaaaagttgcaagaacaaaaggtaatagtttatcggtaggattctcttgtaaatttgaacttgcatctttcaatcttaaacaaaaagcca  1796700
                                                                            *TSS
                                                                           --------->AHL25(2)
                                                                           <---------AHL12(2)
                                                                           --------->AHL12(2)
                                                                           --------->AHL12(3)
                                                                           --------->AHL25(3)
                                                                           --------->AHL20(3)
                                                                           <---------AHL20(3)
                                                                           <---------AHL12(3)
                                                                           <---------AHL25(2)
                                                                          --------->AHL12(3)
                                                                          <---------AHL25(3)
                                                                          <---------AHL12(3)
                                                                          --------->AHL25(1)
                                                                          <---------AHL25(1)
                                                                          <---------AHL25(2)
                                                                          --------->AHL25(2)
                                                                        --------->AHL25(2)
                                                                        <---------AHL20(3)
                                                                   ----------->GT1     <---------GLK1(2)
                     <---------CCA1(2)                        ---------->DOF2         --------->KAN1
                   <---------DOF5.7(1)                    <----------ID1--------->AHL20(3)
              --------->GLK1(1)                         <---------------AtSPL8       ----------->ARR10
              <---------GLK1(1)                        --------->DOF5.7(1)--------->AHL20(2)
             --------->ARR11(3)                       ---------->DOF2   <---------AHL25(2)
>ANAC58      <---------ARR11(3)                       --------->DOF5.7(1) --------->YAB1--------->GLK1(2)
>ANAC58  ---------->DOF2           <---------MYB46(3)--------->DOF5.7(1)--------->AHL20(2) <--------
 
taaacaaaaccaaaaagatttctcttatcttgaaacggtgtttagtcaaaaaaaaaaaaaaggaacaaagaagaaaataatatttggctagattctttgg  1796800
                              ------->TEIL            --------->ANAC58
                          <---------TOE2(3)           --------->ANAC58
                       <---------MYB52(1)            <------NtERF2
                       --------->DOF5.7(2)          ------>NtERF2          --------->ANAC46
                      <-------GAMYB                 <---------ATERF1(1)    --------->ANAC58
                 ----------->HVH21                 --------->DEAR3(1)      --------->ANAC58
                 <---------YAB1                   --------->DEAR3(2)    <---------WRKY38(1)   ------
        --------->GLK1(1) <---------WOX13(2) <------ZmHOX2a(2)          <---------WRKY12      <-----
        <---------KAN1--------->At5g28300   <---------ARR11(3)          <---------WRKY45  --------->ANAC58
--------->KAN1<---------MYB52(1)          ----------->ARR10      <----------DOF2          --------->ANAC58
--DOF2  <---------GLK1(1) --------->WOX13(2)--------->ARR11(3)   <---------DAG2  --------->YAB1   <-
 
ctctcactcgggtttctgttatgaccgttaatgaatttgagcgggaagatcatgccgacgcattgagactttttgtcaacgctataaaaacaaacccaat  1796900
                                                                   <---------DOF5.7(1)
                                                                  ------>ZmHOX2a(1)
                                                             <---------At4g35610
                                                        <---------ANAC58                         <--
                                             <---------RVE1(2)   <---------ALFIN1               <---
--->RVE1(2)                            <---------WOX13(2)    <------------------------ANAC81    <---
------ARR10---------->DOF2            --------->AHL20(2)<---------ANAC58                   <--------
----------GT1                    ------>ZmHOX2a(1)    --------->ICU4                --------->MYB46(3)
 
ctcaccattttcttgaaagctctctctgtctctctcctcgtttatttagactttgcaattcttgtgctcctcttctctacgttttgaacaactcctttgg  1797000
                                               <---------ANAC58                          <---------ANAC55(2)
--------DOF2                                   <---------ANAC58                        --------->CCA1(2)
------ANAC58                                   --------->ANAC55(2)                    <---------ARR11(3)
------ANAC58                                   <---------ANAC46 <----------DOF2       --------->ARR11(3)
--DOF2<-------TEIL                   --------->CCA1(2)   --------->TOE1(2)            <---------RVE1(2)
 
ctttcgcgattcatacaacttctcaccgatatagaagaagagatgagttcgcgtgataaacccaagactttcgcagaagtaagagaagagatatgtaaga  1797100
                --------->ANAC55(2)
                <---------ANAC58
                <---------ANAC58
                <---------ANAC46                   --------->ANAC58
              <---------ANAC58                     --------->ANAC58
              <---------ANAC46                     --------->ANAC46    --------->DOF5.7(1)
              <---------ANAC58             <-----------HVH21      --------->DAG2            <-------
         --------->ATHB12                 <-----------RAV1(1)     --------->DOF5.7(1)  --------->ATHB12
      --------->CCA1(2)       <---------AHL12(2) <---------KAN1 ---------->DOF2     --------->CCA1(2)
 
gaagagaagagatgatttcgcgtgataaccaaaaaaaaaccaagactgtcgcacaagtaagagaagagaaaggtaagagaagggaagagatgatttcgcg  1797200
                                                                                     <---------KAN1
                                                                                   ------>MYB46(1)
                                                                                   ------>MYB83
                                                                             --------->KAN1
                                                                        <---------ANAC58
                     <-----------HVH21                                  <---------ANAC58
           <----------ID1                   --------->DOF5.7(1)         <---------ANAC46
          --------->DOF5.7(1)       --------->DOF5.7(1)                 --------->ANAC55(2)
         --------->DOF5.7(1)     ---------->DOF2                      <---------ANAC58
        --------->DOF5.7(1)  --------->ANAC58                         <---------ANAC58
  ----------------->AGL3     --------->ANAC58    --------->DOF5.7(1)  <---------ANAC46     ---------
<-----------GT1     <-----------RAV1(1)     --------->DAG2       --------->ATHB12------->GAMYB     <
--ANAC46---------->DOF2    <---------KAN1 ---------->DOF2     --------->CCA1(2)  <---------MYB59  <-
 
ttataaccaaaaaaaggccaagactgtcgcacaagtaaaagaagggaaaggtaagagaagagaagagatgatttcgcgtgataaccgaacaaaacccaag  1797300
<- Previous    Next ->

AGI:  At1g05910.1   
Description:  cell division cycle protein 48-related / CDC48-related. similar to AAA-type ATPase family protein [Arabidopsis thaliana] (TAIR:AT3G15120.1); similar to hypothetical protein OsI_030977 [Oryza sativa (indica cultivar-group)] (GB:EAZ09745.1); similar to hypothetical protein OsJ_028841 [Oryza sativa (japonica cultivar-group)] (GB:EAZ45358.1); similar to bromodomain protein 103 [Zea mays] (GB:NP_001105102.1); contains InterPro domain AAA ATPase, conserved site; (InterPro:IPR003960); contains InterPro domain Bromodomain (InterPro:IPR001487); contains InterPro domain AAA+ ATPase, core; (InterPro:IPR003593); contains InterPro domain AAA ATPase, core;
Range:  from: 1790223    to: 1796646    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g05920.1   
Description:  DNA binding. similar to DNA binding [Arabidopsis thaliana] (TAIR:AT3G24850.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN61307.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340); contains InterPro domain Protein of unknown function DUF313 (InterPro:IPR005508)
Range:  from: 1796777    to: 1798253    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version