AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                         <---------ARR11(2)
                   --------->LBD16      <---------AHL12(2)                               --------->ARR11(2)
          <-------MYC3                  --------->AHL20(3)                            <---------ANAC55(2)
          ------->MYC3     <---------TGA1a      --------->ANAC46                      --------->ANAC58
         <---------ANAC55(1)            <---------AHL20(3)                            --------->ANAC55(1)
         <---------O2   --------->ZAT18 --------->AHL25(2)                            --------->ANAC55(2)
    <---------YAB1<---------HSFB2a(2) <---------AHL20(2)                              --------->ANAC58
 --------->ICU4   --------->HSFB2a(2) --------->AHL12(1)                              --------->ANAC46
---MYC2  --------->TGA1a<---------ZAT14 --------->AHL12(2)                   --------->ANAC46
-->MYC2  <---------ANAC58  --------->TGA1a      <---------ALFIN1             --------->ANAC58
-->MYC3  <---------ANAC46  <---------O2 <---------AHL25(2)                   --------->ANAC58     --
---MYC3  <---------ANAC58  --------->O2--------->YAB1                     <---------ATHB12        <-
-->MYC4  <---------TGA1a<---------ZAT18<---------AHL25(3)        --------->YAB5      <---------LBD16
--->KAN1 --------->O2 --------->ZAT2  <---------AHL12(1)         --------->YAB1   --------->KAN1  --
 
tgcgattatgaaacgtgtgttcccgagcacacttgggctaaataataatccacactgcaaaaatacaatcacaacaaatcaagacacatacggaactaga  1668500
                                            --------->At4g35610
                                            <---------ZAT2
                                        ------>ZmHOX2a(2)
                                        ========================HOX2a_HOX2a
                                       =========================HOX2a_HOX2a
                                       <------ZmHOX2a(2)
                                       --------->At4g35610
                                      <-----------ARR10
                                      <---------ARR11(3)
                                      --------->RVE1(2)
                                      --------->ARR11(3)
                                      <---------AGP1
                                      --------->GATA12
                                      <---------GATA12
                                      --------->ARR11(2)
                                      <---------ARR14(2)
                                      --------->ARR14(2)
           <---------REM1(1)          <---------ARR11(2)
          <---------TOE2(3)           --------->GLK1(2)
    <---------AHL20(2)           <---------TOE1(1)
    <---------AHL25(3)          --------->SPL7(1)             --------->CCA1(2)
    <---------AHL25(2)        --------->TOE1(2)              <---------ARR11(2)
    --------->AHL12(1)        <---------SPL7(1)              <---------ARR14(2)
    --------->AHL25(2)        --------->TOE2(2)      --------->DOF5.7(1)
    <---------AHL25(1)       <---------ANAC55(2)--------->ANAC58         ----------->GT1
    <---------AHL20(3)      --------------->AtSPL3  --------->DOF5.7(1)<---------ANAC46
    <---------AHL12(1)   <---------ANAC58   --------->ZAT2   --------->ARR14(2)
    --------->AHL20(2)   <---------ANAC58   <---------At4g35610<-------TEIL    <---------RVE1(2)
------->At4g35610   <---------ICU4   <------ZmHOX2a(1)   <------ZmHOX2a(1) <--------P       --------
--------At4g35610  --------->ICU4<---------TOE2(1)---------->DOF2     --------->ALFIN1      --------
--------->GT1 ----------->GT1--------->ANAC55(2)--------->ANAC58     <-----------HVH21  <------ZmHOX2a(1)
 
gagctaaaaaattgatgtagcaaaaattgcatacgtacgaggatctgagctacgaaaggaggaagatacaagggtcgggttagatagtagaggacacgat  1668600
            ---------->DOF2
       <---------HSFB2a(2)       --------->ANAC58           <---------At4g35610
       --------->HSFB2a(2)       --------->ANAC58           --------->At4g35610
     <-------TEIL    <---------ANAC58                 --------->SPL7(1)                   ----------
 <---------TOE2(3)   <---------ANAC46               <---------ZAT18                     <---------HSFB2a(2)
 <---------TOE1(3)   <---------ANAC58               --------->ZAT18                 <---------DOF5.7(1)
 ----------->ARR10   --------->ANAC55(2)           <---------ANAC58      <----------DOF2--------->HSFB2a(2)
->ANAC58 ----------->RAV1(1)   --------->MYB52(1)  <---------ANAC58      <---------DOF5.7(1)
->ANAC58<----------ID1    <---------YAB1  --------->DOF5.7(1)           <---------DOF5.7(1)
 
agctaaggttcgcgacaaagagttgcgttatgaagaacggaagggaagaggctagcgtacttccgctctcccatcccttttgttctctcttctcaaagag  1668700
                                                                                  --------->SPL7(1)
                                                                                --------->LBD16
                                                                               <---------HSFB2a(2)
                                                                               --------->HSFB2a(2)
                                                                              <------NtERF2
                                                                            --------->ARR14(2)
                                                                            <---------ARR11(2)
                                                                            <---------DEAR3(1)
                                                         <---------KAN1     <---------ARR14(2)
                            ---------->DOF2             --------->ARR14(2)  --------->ARR11(2)
                         <---------HSFB2a(2) <---------YAB1                --------->ATERF1(1)
                         --------->HSFB2a(2)--------->ARR11(3)             <---------ABI4(2)
                    <---------DOF5.7(1)     <---------ARR11(3)        --------->DOF5.7(1)
                    <---------ICU4          --------->RVE1(2)---------->ID1<---------GLK1(1)
                    --------->YAB5 --------->GLK1(2)    <---------ARR14(2)<---------ATERF1(1)
                  --------->GLK1(2)--------->ARR14(2)   --------->GATA12 <---------DEAR3(1)      <--
              --------->ANAC58     <---------ARR14(2)  <------ZmHOX2a(1) <---------RAP2.3(3)    ----
              --------->ANAC46    <---------GLK1(2)  --------->MYB59 --------->DOF5.7(1)       -----
>DOF2         --------->ANAC58--------->ANAC46--------->YAB1<-----------HVH21 <---------LBD16------>ZmHOX2a(1)
 
aagactttggtcataacacacaatctttccaaaacgcgattcttcaatatcatagttaggatttgtcacattaaggggggctccggaagacatctcctcc  1668800
                                                          <------MYB83
             --------->ARR11(2)                           <------MYB46(1)
             --------->ARR14(2)                          --------->MYB46(2)
             <---------GLK1(1)                           --------->MYB52(2)
             <---------ARR14(2)                          --------->MYB111(1)
            <---------GLK1(2)                            --------->MYB59
         --------->ETT(1)   --------->YAB1              <---------MYB55(1)
      <------MYB46(1)       --------->YAB5            --------->TOE2(3)        <-------TEIL
      <------MYB83      --------->DOF5.7(1)        ------>MYB83        --------->ATHB12
     <---------MYB46(3)<---------AHL12(3)          ------>MYB46(1)--------->ANAC46
    <---------ANAC58   <---------AHL25(1)          --------->MYB52(1) <---------YAB5
    <---------ANAC46   --------->AHL25(2)        --------->MYB46(3)  <<<<<<<<<<<<<<<<<LFY
    <---------ANAC58   --------->AHL20(2)       --------->ANAC58  --------->ANAC58
  <---------MYB46(3)   <---------AHL25(2)       --------->ANAC58  --------->ANAC58
-------TOE1(2)   --------->LBD16               ------->TEIL   <-----------RAV1(2)         <---------ZAT14
-->ZmHOX2a(1)--------->GLK1(1)            ----------->RAV1(2)<-------TEIL   <---------ANAC58
---->TOE1(2)--------->ARR11(2)       --------->ARR14(2)<---------MYB52(1)   <---------ANAC58   -----
 
tacgatggctggtcggaatccccaaaaaaaatgacaatactatctgcctgaacccaacgttaggttcagacgaaacattgggttcatatagactgcaata  1668900
                                               -------->HAHB4
                                               --------->AHL20(2)                --------->TOE2(3)
                                               --------->YAB1                --------->GLK1(1)
                                              <---------YAB5                 <---------GLK1(1)
                                              <---------YAB1         <------------CBF            <--
                                             --------->WOX13(2)     --------->ATHB12  --------->MYB46(3)
   --------->WOX13(2)                        <-----------TBP       <---------YAB5--------->WOX13(2)
*TSS                                    ----------->GT1            <---------YAB1<---------WOX13(2)
---->YAB1                    --------->ZAT14 <---------WOX13(2)   <-----------HVH21 <-----------GT1
 
acaactaatttgcaacctcttccaagttttagttcagacgagatggctaattatagatgatgtattagttgtcattggggaattcattaaccactcgttt  1669000
                                     <----------DOF2
                                     <---------DAG2
                                <------MYB46(1)
                                <------MYB83
                                <---------ANAC58
                                <---------ANAC58
                               --------->MYB111(2)
                               --------->MYB46(2)
                               --------->MYB52(2)            <---------ICU4
                               --------->MYB59               --------->YAB1
             --------->GATA12  --------->MYB111(1)           --------->YAB5                       <-
             <---------GATA12 <---------MYB55(1)            --------->ICU4                       <--
          --------->YAB1     <---------MYB52(1)     <-------GAMYB                                ---
        --------->RVE1(2)   <-------GAMYB          <------MYB83                                  <--
     <---------ANAC58       <-----------HVH21      <------MYB46(1)                         ---------
     <---------ANAC58      <----------DOF2         <---------MYB46(3)                 ---------->ID1
-------AHL20(2)  <---------TOE2(3) <-------TEIL    ----------->GT1           <---------ARR11(3)<----
 
taaaatgggcttatcagatttatgtttttgctgttaggtgcttttttaaacggctggttgaaaatgatcacttgtttcaacatatttttgtccgatttct  1669100
                            <---------AHL12(2)
                            --------->AHL12(2)
                            <---------AHL25(2)
                            --------->AHL25(2)
                            --------->AHL20(3)
                            <---------AHL20(3)
                            <---------AHL25(3)
                           --------->AHL25(1)
                           <---------AHL12(3)
                           <---------AHL20(2)
                           --------->AHL12(3)
                           --------->AHL25(2)
                           --------->AHL25(3)
                           <---------AHL25(2)
                           <---------AHL12(1)
                           --------->AHL12(1)
                           <---------AHL25(3)
                           --------->AHL20(2)
                           <---------AHL25(1)
                          --------->AHL12(1)
                          <---------AHL20(2)
                          --------->AHL12(3)
                          <---------AHL25(1)
                          --------->AHL25(1)
                          --------->AHL20(2)
                          <---------AHL20(1)
                          --------->AHL25(3)
                          <---------AHL25(2)
                          --------->AHL25(2)
                          <---------AHL12(1)
                         <---------AHL12(2)
                       --------->AHL20(3)
                       <---------AHL20(1)
                       <---------AHL20(2)
                       --------->AHL25(2)
                       <---------AHL25(1)
                       --------->AHL25(1)
                       --------->AHL20(1)
                       <---------AHL20(3)
                       --------->AHL12(1)
                       --------->AHL20(2)
             <---------ARR14(2)
             <---------ARR11(3)
             --------->ARR14(2)
             --------->ARR11(3)
             --------->GLK1(2)
             --------->GATA12
      <---------ARR11(2) --------->AHL12(2)
      --------->ARR11(2)--------->AHL12(2)
     --------->At5g28300<---------AHL12(2)
     <-------GAMYB     <---------AHL25(3)
    ----------->GT1    <---------AHL25(2)
 <<<<<<<<<SPL5         --------->AHL25(3)
 <<<<<<<<<SPL1         <---------AHL12(1)
 <<<<<<<<<SPL4        <---------KAN1
--------------AtSPL3  --------->AHL25(3)
----------------SPL14 --------->AHL20(2)                                                    <-------
------>WOX13(2)--------->TOE1(2)                                       <-----------GT1    <---------DOF5.7(1)
-------WOX13(2)--------->TOE2(2)     --------->YAB1                  --------->AHL20(2)  <----------DOF2
>GLK1(1)     <---------GATA12       <---------ATHB12       --------->TOE2(3)         <----------DOF2
-----YAB1    --------->RVE1(2)    --------->WOX13(1)     <-----------GT1          <-----------GT1
 
aattgtacggttacaaaatctgcgaataaattattttcaatcaaacttatagatgttttttttcttaacaaattatacaagtttttttctttcttttttt  1669200
                                                        --------->TOE1(2)
                                                        --------->TOE2(2)
                                                  --------->WOX13(2)                      <---------YAB1
                                                <---------YAB1                           --------->AHL25(2)
                                               <---------AHL12(2)                        <---------AHL25(1)
                                               --------->AHL12(2)                        <---------AHL25(3)
                                              <---------AHL25(3)                         --------->AHL25(1)
                                             <---------AHL25(1)                          --------->AHL20(3)
                                             <---------AHL25(2)                          <---------AHL20(3)
                                             --------->AHL25(2)                          --------->AHL20(2)
                                             --------->AHL20(1)                          <---------AHL20(2)
                                             --------->AHL25(1)                         <---------AHL20(2)
                                             <---------AHL20(3)                         --------->YAB1
                                             <---------AHL20(2)                       --------->WOX13(2)
                                             <---------AHL20(1)                       <---------AHL12(2)
                                             --------->AHL20(3)                      --------->YAB1
                                             --------->AHL25(3)                      --------->ATHB51
                                             --------->AHL12(1)                      <--------HAHB4
                                             <---------AHL12(1)                      <---------AHL25(3)
                                             --------->AHL20(2)                      --------->YAB5
                                             <---------AHL25(3)                      <---------ICU4
                                           --------->WOX13(2)                        -------->HAHB4
                                           <---------WOX13(2)                        <--------ATHB1
                                           <---------AHL12(2)                       --------->AHL25(3)
                                           --------->AHL12(2)                       <---------ATHB51
                                          --------->AHL20(2)                        --------->ICU4
                                          --------->AHL20(3)                        <---------YAB1
                                          <---------AHL20(2)                        <---------AHL12(1)
                                          <---------AHL25(3)                        --------->AHL20(2)
                                         <---------AHL25(1)                        --------->AHL12(2)
                                         <---------AHL20(2)                        <---------AHL12(2)
                                         --------->AHL20(2)                        <---------AHL12(3)
                                         --------->AHL12(1)                        <---------AHL25(2)
                                         --------->AHL25(1)                        --------->AHL20(3)
                                         --------->AHL25(3)                        <---------AHL20(3)
                                         <---------AHL12(1)                        --------->AHL25(2)
                                        --------->AHL12(2)                         --------->AHL12(3)
                      <---------YAB1    <---------YAB1 --------->YAB1             <---------ICU4
                      <---------TOE2(3) <---------AHL12(2)                     --------->YAB1
                  --------->YAB1       --------->AHL12(2)                     <---------AHL20(2)
                 <---------ATHB51     --------->YAB1  <---------YAB1  --------->GLK1(2) --------->AHL20(2)
               --------->YAB1         <--------HAHB4  <---------TOE2(3)   <----------DOF2<---------AHL12(3)
              --------->ZAT6         <---------YAB1<---------YAB1    <---------GLK1(2)<---------WOX13(2)
       <---------ARR14(2)    --------->ZAT14--------->AHL12(2)    --------->YAB1  --------->YAB1
-----------------ANAC81 --------->ARR11(3)<---------AHL20(3) ------------>CBF--------->AHL20(2)
 
ttgtttggcagttcttaacaataataagatagtttagtctattattaatttattattaacataagacaataagattcctttttaataataattaaaatag  1669300
                                                                                         --------->ANAC58
                                                                                     --------->HSFC1(1)
                                                                                     --------->HSFB2a(2)
                                          <---------YAB1                             <---------HSFC1(1)
                                        <-----------GT1                          ------>ZmHOX2a(2)
                                       <---------YAB1                           <------ZmHOX2a(2)
                                 <---------AHL25(3)                            <---------ARR14(2)
                                 <---------AHL12(3)                            --------->ARR11(3)
                                 --------->AHL12(3)                            --------->ARR14(2)
                                 <---------AHL20(2)                            <---------ARR11(2)
                                 --------->AHL20(3)                            --------->ARR11(2)
                                 --------->AHL20(2)                            --------->RVE1(2)
                                 --------->AHL25(2)                            <---------RVE1(2)
                                 --------->AHL25(1)                            <---------GLK1(2)
                                --------->AHL25(3)                             <---------ARR11(3)
                                <---------AHL12(3)                             <---------ARR14(3)
                                <---------AHL12(1)                             --------->GATA12
                                --------->AHL12(2)                             <-----------ARR10
                                --------->AHL12(1)                             --------->ARR14(3)
                                --------->AHL25(1)                             <---------GATA12
                                <---------AHL25(2)                       --------->GLK1(2)
                                --------->AHL25(2)                       --------->ARR14(2)
                               <---------AHL12(1)                        --------->RVE1(2)
                               --------->AHL12(1)                        <---------ARR14(2) --------
                <---------AHL12(3)  <---------YAB1                      <---------GLK1(2)--------->ANAC58
                <---------AHL12(2)  <---------AHL20(2)           --------->WOX13(1) <---------LBD16
               --------->YAB1 --------->AHL12(2)               <---------ATHB12<---------AGP1
               <---------AHL25(3)<---------AHL20(3)           --------->RVE1(2)--------->AGP1
              --------->AHL20(2)<---------AHL25(1)       --------->RVE1(2)    <---------CCA1(2)
          ------------>CBF    --------->GLK1(2) *TSS---------->DOF2   --------->LBD16<---------HSFB2a(2)
 
acaagtagtagaatacaataaatatgcaacgagaatttttttattactataatgcaaaagtatcaaatcaatccagaatccagatcttctggaagcaaag  1669400
<- Previous    Next ->

AGI:  At1g05580.1   
Description:  ATCHX23 (CATION/H+ EXCHANGER 23); monovalent cation:proton antiporter. similar to ATCHX21 (CATION/H+ EXCHANGER 21) [Arabidopsis thaliana] (TAIR:AT2G31910.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42759.1); contains InterPro domain Sodium/hydrogen exchanger; (InterPro:IPR006153)
Range:  from: 1665463    to: 1668901    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g05590.1   
Description:  ATHEX3/HEXO2 (BETA-HEXOSAMINIDASE 2); beta-N-acetylhexosaminidase/ hexosaminidase/ hydrolase, hydrolyzing O-glycosyl compounds. similar to ATHEX2/HEXO1 (BETA-HEXOSAMINIDASE 1), beta-N-acetylhexosaminidase/ hexosaminidase/ hydrolase, hydrolyzing O-glycosyl compounds [Arabidopsis thaliana] (TAIR:AT3G55260.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO67165.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN76146.1); similar to hypothetical protein OsJ_023880 [Oryza sativa (japonica cultivar-group)] (GB:EAZ40397.1); contains InterPro domain Glycoside hydrolase, family 20, catalytic core (InterPro:IPR015883); contains In
Range:  from: 1669349    to: 1671875    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version