AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   <
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                ----------->GT1                   <-
                                                              <---------TOE2(3)                   --
                                               <---------YAB5 <---------TOE1(3)                   <-
             --------->At4g35610     <---------YAB1     --------->ATHB12                          --
             <---------ZAT2          <---------TOE2(3) --------->ICU4                             <-
 --------->RAP2.6(2)           <---------------AGL15   <---------YAB1                             --
 --------->ANAC46--------->REM1(1) --------->YAB1 <---------At4g35610                        -------
---->TOE2(3) <---------At4g35610  <---------YAB1  --------->At4g35610        --------->RVE1(2)  ----
----YAB1 <-----------HVH21     --------------->AGL15   <---------YAB5--------->YAB1  <---------MYB52(1)
 
atagccgaaaccagtcagctacacgagtacaagacttattatggtatgtagtcatctcatgatttaagggtataatgaagtatcaactgttagtccccca  1624600
    --------->WOX13(2)
    <---------WOX13(2)
   <---------ICU4
  ------>ZmHOX2a(1)
  <---------YAB1
 <---------MYB59
------>ZmHOX2a(2)
------ZmHOX2a(2)
--------GATA12
------->GATA12                                               <---------ATHB12
------->RVE1(2)                                --------->GLK1(1)
--------ARR14(3)                              <---------GATA12
--------ARR11(3)                              --------->GATA12                         ----------->HVH21
------->ARR14(3)                              --------->ARR14(2)                     <---------At4g35610
--------ARR14(2)                              --------->ARR11(2)             <---------KAN1
------->ARR14(2)         --------->ZAT14      <---------ARR14(2)            --------->ICU4
--------ARR11(2)    --------->GLK1(1)         <---------ARR11(2)         <---------YAB1----------->TGA1
------->ARR11(3)    <---------GLK1(1)         <---------RVE1(2)    <---------YAB5    --------->LBD16
-->LBD16    <---------YAB1                   <------ZmHOX2a(1)    <-----------HVH21 <---------ANAC46
------->ARR10   --------->YAB1  <---------CCA1(2)   ---------->DOF2<---------YAB1  <---------LBD16
 
agatcctaattgcatatgatcagaactctggactcgtttcttaagtgaggatttgcaaagctcaatctttgtcattgcgattatgttccggtgacgatgt  1624700
             <---------ARR14(2)
             --------->GATA12
             <---------GATA12
          --------->LBD16
         <---------LBD16
         --------->LBD16                                                                 -----------
        <---------ANAC46                                                              --------->GLK1(2)
        <---------LBD16                                                     <---------ARR11(3)
       <---------LBD16                                                      <-----------ARR10
    <----------DOF2                                                         --------->ARR11(3)
 <---------ARR11(3)                                                         <---------GATA12
 --------->RVE1(2)                                                          --------->RVE1(2)
 --------->GLK1(2)                  <----------DOF2             --------->RVE1(2)    <---------ARR14(2)
 --------->ARR11(3)             <----------DOF2        <----------DOF2     <---------GLK1(2) -------
 <-----------ARR10             <---------DOF5.7(1)   ---------->ID1---------->DOF2   <---------GLK1(2)
 
tcaaaatctttccggggatttagttccatcactgtctttcttttctatttgtttttgtctttaacaatgtcaaagtcaaaatctcaccgattctgtaaat  1624800
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                       --------->ATHB12                                                          <--
              <---------YAB5                                                                     ---
             <-----------HVH21                                                                   ---
          --------->TGA1a                                                                      -----
          <---------O2 --------->ATHB51                       <---------DEAR3(2)               <----
          --------->O2<---------YAB1                          <---------MYB46(3)        --------->GLK1(2)
          <---------bZIP60(2)                                <---------At1g77200      <---------AHL20(2)
          <---------TGA1a                                  <-----------HVH21         <---------AHL12(2)
          <---------ANAC55(1)                          <---------DEAR3(1)           --------->AHL12(2)
          <---------ANAC55(2)                       <---------ANAC46                <---------AHL12(2)
          <---------ANAC58                          <---------ANAC58               --------->AHL20(1)
          --------->ANAC55(2)                       <---------ANAC58              --------->AHL25(1)
          =================================================bZIP_DOF               --------->AHL12(3)
          <---------ANAC46                          <---------RAP2.6(2)    <---------LBD16 ---------
          <---------ANAC58                      <----------DOF2<-------GAMYB      <---------AHL12(3)
         ----------->STF1      <---------ANAC58<---------DOF5.7(1)  --------->ZAT18<---------AHL20(1)
>GT1   ----------->TGA1-------->ATHB1       <---------ALFIN1 <---------DEAR3(1)   --------->AHL20(2)
-->KAN1----------->HVH21       <---------ANAC58--------->TOE2(3)    <---------ZAT18<---------AHL25(3)
 
tccaagttatatgacgtgtcattgtattattggtgcgagcgatagcacaacctttgcgtctgcgtcggtagcgaactcttcggaaatatataatctgtaa  1624900
                                                                                    <-----------GT1
                                                                                 --------->AHL12(2)
                                                                                 <---------AHL12(2)
                                                                                --------->AHL20(2)
                                                                                <---------AHL25(3)
                                                                                --------->AHL20(1)
                                           <---------YAB1                       --------->AHL12(1)
                                          --------->AHL12(2)                    <---------AHL12(1)
                                          <---------AHL12(2)                    <---------AHL20(1)
                                         --------->AHL12(3)                     <---------AHL20(3)
                                         --------->AHL25(1)                     <---------AHL20(2)
                                         <---------AHL20(2)                     <---------AHL25(1)
                                         <---------AHL25(3)                     --------->AHL25(2)
                                         <---------AHL25(1)                     --------->AHL25(3)
--------AHL25(3)                         <---------AHL12(1)                     <---------AHL25(2)
------->AHL25(2)                         --------->AHL20(2)                     --------->AHL25(1)
--------AHL25(1)                         --------->AHL12(1)                    <---------AHL12(3)
------->AHL20(2)                         <---------AHL12(3)                    --------->AHL20(2)
--------AHL20(2)                        <---------AHL20(2)                     --------->AHL12(3)
--------AHL20(3)                 <----------DOF2                               --------->AHL25(1)
------->AHL25(1)                --------->TOE2(3)                              <---------AHL25(1)
-------AHL20(2)    <---------AHL20(2)  --------->AHL12(2)                      --------->AHL25(3)
------>AHL20(2)   --------->AHL20(2) <---------AHL20(2)                   ----------->GT1
------>YAB1     --------->WOX13(2)  --------->AHL25(3)             --------------->AGL15      <-----
---->WOX13(2)   <---------WOX13(2)<---------DOF5.7(1)  ------>ZmHOX2a(1)---------->DOF2     <-------
-----WOX13(2)------------>CBF   <---------DOF5.7(1)  *TSS      --------->GLK1(1)--------->AHL20(3)
-->GT1   --------->KAN1--------->RVE1(2)--------->AHL25(3)     <---------GLK1(1)<---------AHL12(3)
 
ttaaaatgagactaatcccaatttaaaatcaaaaacctttttatttatttttgttttcctatagagatttcttagaaaagaaataaattacttctctttt  1625000
                                   --------->ALFIN1
                           --------->GATA12
                           --------->ARR14(2)                                            <---------AHL12(2)
                           <---------ARR14(2)                                           <---------AHL20(2)
                           --------->GLK1(2)                                           --------->AHL25(3)
                           ------->TEIL                                          --------->LBD16
                           <---------ARR11(2)                                  <---------LBD16
                           --------->ARR11(2)                                --------->ARR14(2)
                           <---------GATA12                                  <---------GATA12
                          <---------GLK1(2)                                  --------->GATA12
                     <---------ARR11(2)                                      <---------ARR11(2)
                     --------->ARR14(2) <-------GAMYB                        <---------ARR14(2)
                     <---------ARR14(2)--------->MYB52(2)                    --------->ARR11(2)
                     --------->ARR11(2)<---------MYB46(3)                ----------------->AG
  --------->KAN1 <-------PIF5    <---------ANAC46                      <-----------GT1 --------->AHL20(2)
----AHL20(2)     ------->PIF5    <---------ANAC58                    <---------AHL12(1)--------->AHL25(1)
---DOF2      <---------At4g35610 <---------ANAC58           <---------KAN1<---------------AGL15
 
atttttcattcggtttagctcgtggaactgaatctggtgtgtttgttgatcagagtaatacggacattgcaatttttctaaatccggcgattaaatatgg  1625100
                                             --------->ATHB12
                                             <---------ICU4
                                            <---------YAB5
                                          --------->YAB1
                                          --------->YAB5                         --------->ZAT2
                                          <---------ICU4                         <---------HSFC1(2)
                                         <---------YAB5                          <---------ZAT2
                                         --------->ICU4                          --------->HSFC1(2)
                                         <---------ATHB12                   <------ZmHOX2a(2)
                                       --------->WOX13(1)                  --------->GATA12
                                    --------->ANAC58                       --------->ARR11(2)
          <-------GAMYB             --------->ANAC58                       <---------GATA12
         <---------DEAR3(1)      --------->ARR11(2)                        <---------ARR11(2)
        <------NtERF2            <---------ARR11(2)                     <---------HSFB2a(2)
       <---------ORA47(2)        <---------ARR14(2)                 <---------ARR14(2)
      <---------DEAR3(1)         <---------GLK1(2)                  --------->ARR14(2)
      <---------RAP2.3(3) ------>ZmHOX2a(1) <---------YAB1          --------->GLK1(1)
--------->YAB1   <---------YAB5  --------->ARR14(2) <----------DOF2 <---------GLK1(1)
 
gtttcatagtcggcgttgtaatcggactcctcgtcggaatcgcaatcatcatcggctttgtcaagttggagaattctcgatccaagcttcgctctgaact  1625200
                                                                                            <-------
                                                                                           ---------
                                                                                           <--------
                                                                                          <---------ATERF1(1)
                                                                                          <---------MYB46(3)
                                       <---------AHL12(3)                                 --------->MYB55(2)
                                       <---------AHL25(2)                                 ------>NtERF2
                <---------DOF5.7(1)    --------->AHL12(2)                                 --------->ABI4(2)
               <---------DAG2          --------->AHL25(1)                                <---------DEAR3(1)
               <----------DOF2         <---------AHL20(2)                                --------->ALFIN1
               <---------DOF5.7(1)    <---------DOF5.7(1)                           <---------KAN1
              <---------DOF5.7(1)     <---------AHL12(1)                           <---------ARR14(2)
        <---------ALFIN1     <---------AHL12(1)                                    --------->ARR14(2)
      <---------ALFIN1       --------->AHL12(1)           <---------ARR14(2)       --------->ARR11(2)
   --------->PCF2        ----------->GT1<---------AHL12(2)<---------RVE1(2)        <---------ARR11(2)
   --------->ANAC58     <---------WOX13(1) <-----------GT1--------->ARR14(2) --------->DOF5.7(1)<---
   --------->ANAC58<---------LBD16  <---------RVE1(2) <---------LBD16        --------->DAG2<------NtERF2
 
tgtgagaccccactctccctttttcggattgaaaatttcgattttttttcttcttaatcgggattttgtttctgttttataaggcgaatacggtggctgc  1625300
                   <---------ARR14(2)
                   <---------ARR11(2)
                   --------->ARR14(2)
              <---------MYB46(3)
        --------->MYB52(1)<------ZmHOX2a(1)                 <---------ANAC58
       ----------->HVH21--------->LBD16                     <---------ANAC58
       ----------->TGA1<---------LBD16                   ------>ZmHOX2a(1)
       <---------KAN1  --------->HSFB2a(2)               --------->LBD16
     <------ZmHOX2a(1) <---------HSFB2a(2)             ----------->RAV1(2)
 <---------ANAC58 <---------HSFB2a(1)    --------->LBD16<---------LBD16
 <---------ANAC58 <------ZmHOX2a(1)      ------>ZmHOX2a(1)  <-------GAMYB
 <---------ANAC46 --------->HSFB2a(1)  ----------->RAV1(2)<---------TOE1(2)                 --------
--RAP2.6(2)  --------->ALFIN1  <----------DOF2   <-----------GT1                          <---------
>ATERF1(1)<---------DREB2C(2)--------->HSFC1(2) --------->KAN1                         ----------->GT1
-At4g35610<---------DEAR3(1) <---------HSFC1(2) <-----------GT1               <-----------RAV1(2)
-------DOF2 <---------------------WRI1------>NtERF2  ------>ZmHOX2a(1)      <-----------HVH21  <----
 
ttttgcgaggatgacggtggaggattccaggaagcttttgcctcctgagttttatccttcctgggttgtcttctccgagcgtcagaagttgagttacaac  1625400
                                       <---------ARR11(2)
                                       --------->ARR11(2)                                          <
                                       --------->ARR14(2)                                    <------
                                    <---------ANAC58                                  <---------YAB1
                                    <---------ANAC58                                 <---------GLK1(2)
                                    <---------ANAC46 ---------->DOF2     --------->ICU4      <------
    --------->ANAC55(2)       <----------DOF2      --------->ANAC58      <---------YAB1      <------
->REM1(1)                    <---------DOF5.7(1)   --------->ANAC58 <------MYB83    --------->YAB5<-
--GT1<---------RVE1(2)<---------CCA1(2)<---------ARR14(2)           <------MYB46(1) --------->KAN1<-
-----ICU4             <---------At4g35610          --------->ANAC46--------->MYB59 <---------YAB5 <-
 
attacttacatattgatgtgttttcatctctctctttctgcgtattggaagaacacgaaagttttagaatttggtcatacttgggactgattcttgttgt  1625500
<- Previous    Next ->

AGI:  At1g05500.1   
Description:  ATSYTE/NTMC2T2.1/NTMC2TYPE2.1/SYTE. similar to ATSYTD/NTMC2T2.2/NTMC2TYPE2.2/SYTD [Arabidopsis thaliana] (TAIR:AT5G11100.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69290.1); similar to unknown [Populus trichocarpa] (GB:ABK94033.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN84059.1); contains InterPro domain C2 calcium-dependent membrane targeting (InterPro:IPR000008); contains InterPro domain C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973)
Range:  from: 1624954    to: 1629223    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version