AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                              --------->ARR14(2)
                                                                              <---------ARR11(2)
                                                                         ------>NtERF2
                                                                        ------>NtERF2
                                                                        --------->RAP2.6(2)
                                                                       <---------ANAC46
                                                                      --------->ATERF1(1)
                      --------->MYB52(1)                             --------->LBD16
                     <---------ARR11(2)                            <---------LBD16
                     --------->ARR14(2)                          --------->ARR14(2)
                     <---------ARR14(2)                          <---------ARR14(2)
                     --------->ARR11(2)                          <---------ARR11(2)
                   --------->ANAC46                              --------->ARR11(2)
                 ----------------->AGL3                         --------->KAN1<---------ARR14(2)
                 ----------------->AGL2                         <---------GLK1(1)
       --------->ANAC46      --------->ANAC58                   <---------KAN1--------->ARR11(2)
       --------->ANAC58 --------->ANAC58               <---------ANAC55(2)    --------->MYB52(1) ---
-------->KAN4(2) <-----------------AGL1                --------->ANAC55(2)    --------->RVE1(2)  ---
--------HSFB2a(1)<------NtERF2<---------MYB52(2)     <-----------------AG<------NtERF2           ---
---------TaMYB80 ----------------->AGL1     <---------ZAT14     <----------TaMYB80              <---
------->HSFB2a(1)======================================================MADS_MADS               -----
------->KAN1     --------->At4g35610        --------->ZAT18     --------->GLK1(1)             ------
-----TEIL       ----------->RAV1(1)         <---------ZAT18    <---------RVE1(2) <---------SPL7(1)
--->TOE1(1) --------->DOF5.7(1)   <---------KAN1     <-----------------AGL1  <---------KAN1  -------
-ZAT2  --------->ANAC58 --------->ANAC58    --------->ZAT14    --------->ARR11(2)----------->HVH21 <
-->RAV1(2)---------->DOF2    --------->ANAC58      <------ZmHOX2a(1)--------->ANAC46         -------
 
tacattccccaagcaaaggcaccagaaacggcaaggaacatggccattgcactaggacccgtattggatatccggcgggcatatcggaccggtgcgaacc  1290900
        ------>NtERF2                 --------->KAN1
      <---------ANAC46                --------->ZAT6
      <---------ANAC58            ------>ZmHOX2a(1)
      <---------ANAC58        --------->ARR14(2)
     --------->ATERF1(1)      --------->RVE1(2)
    <---------MYB46(3)        <---------ARR11(2)
    ------>NtERF2             --------->ARR11(2)
   --------->ALFIN1           <---------ARR14(2)
   <---------DEAR3(1)        --------->GLK1(1)
  <---------MYB52(1)         --------->KAN1
  <-----------HVH21          <---------KAN1                                 <-----------HVH21
 --------->LBD16             <---------GLK1(1)                              <-----------TGA1
--->MYB83--------->SPL7(1)   <---------CCA1(2)                    --------->YAB1
----->P <------NtERF2  --------->At4g35610                       <---------YAB1
--->MYB46(1)           <---------At4g35610--------->ANAC58       <---------YAB5
------ALFIN1    ------>ZmHOX2a(1)--------->TOE1(3)    <---------ANAC58     --------->ANAC46
---->MYB46(3)------>MYB83 <------NtERF2   --------->ANAC58   <---------ANAC58   --------->At4g35610
--->DEAR3(2) ------>MYB46(1)---------->TaMYB80        <---------ANAC58   ------>NtERF2  ------->GAMYB
-->PCF2<---------SPL7(1) --------->RAP2.6(2)          <---------ANAC46   <---------ATERF1(1)
---------LBD16----------->RAV1(2)--------->TOE2(3) ------>ZmHOX2a(1)    --------->DEAR3(1)
>TEIL<------NtERF2  <---------At4g35610   --------->ANAC46   <---------ANAC58<---------MYB52(1)<----
 
cacccggtggcggaccatcctgaagcagcggcatatccttcacactcgccattcctggcttatttcttatcatcgcctccgtcatcttcaacgctcaatt  1291000
                                           <---------At4g35610
                                           --------->At4g35610    <---------ARR11(2)
                                      <---------RVE1(2)           --------->GLK1(2)
         <---------WOX13(2)      <---------GATA12                --------->GLK1(1)
         --------->WOX13(2) <---------GATA12                <---------HSFB2a(2)         --------->HSFB2a(1)
        ------>MYB46(1)     <---------ARR14(2)              >>>>>>>ZML2          --------->MYB52(1)
        ------>MYB83        --------->GATA12            <---------ZAT14        <---------MYB52(2)
      <---------MYB59       --------->ARR11(2)          --------->ZAT18      --------->MYB52(1)    <
 <---------HSFB2a(2)        <---------ARR11(2)         <---------KAN1 --------->At4g35610     <-----
 --------->HSFB2a(2)        --------->ARR14(2)        >>>>>>>>>TAC1   <---------At4g35610--------->TOE1(2)
-----ARR11(3)  <----------DOF2   --------->GATA12<<<<<<<<<<GATA-1<---------GLK1(1)      <---------HSFB2a(1)
 
tcttctcgaccaaattgacttttgatcactgaatccgatttgattttgctgaaatcgagtgttctagggattccgatgaacaacgaagggaacgttggag  1291100
                                                                                                 ---
                                            --------->ANAC46                                     ===
                                            --------->ANAC55(2)                                  ===
                                            <---------ANAC55(2)                           --------->CCA1(2)
          *TSS                             <---------LBD16                               --------->ARR11(2)
          <------ZmHOX2a(1)               --------->MYB52(1)                             <---------ARR14(2)
<---------WOX13(2)                       <---------ATHB12                                <---------ARR11(2)
--------->WOX13(2)              --------->WOX13(2)                       --------->WOX13(2)<--------
-----------GT1               <---------MYB52(1)   <---------ANAC46   <----------DOF2     --------->ARR14(2)
----RVE1(2)        --------->WOX13(2)   --------->RVE1(2)--------->At4g35610             <---------RVE1(2)
 
attaactaggctaggaccatataactaagcccattagttagcaaatcacggagtcgtatgagatgaaatgggctataactaagcccatttcagatatgtt  1291200
                                     <---------ANAC55(2)
                                     --------->ANAC55(2)
                                     --------->TGA1a
                                     --------->O2
                                     <---------ANAC46
                                     <---------TGA1a
                                     --------->bZIP60(2)
                                     <---------bZIP60(1)
                                     --------->bZIP60(1)
                                 <-----------HVH21
                             --------->ALFIN1
                            ------->PIF5
                            <-------MYC2
                            <-------MYC3
                            ------->MYC2
                            ------->MYC3
                            <-------PIF5
                           <---------TGA1a
                           <---------bZIP60(2)
                           <---------O2
                           <---------ANAC55(2)
                           <---------ANAC46
                           ====================bZIP_bZIP
                           --------->O2
                        ----------->HVH21
                       <-----------HVH21                                                         <--
                      --------->ANAC58      <---------ARR11(3)                                <-----
                      --------->ANAC58------->MYC3                                            <-----
                  --------->ANAC58   <---------O2                                             ------
         <-------TEIL --------->ANAC46<-------MYC3 <<<<<<<<<TBF1           <---------MYB59    ------
------->DOF2      --------->ANAC58 ------------->DYT1 <<<<<<<<<TBF1     --------->ZAT18      -------
===============================================bZIP_DOF            --------->AHL20(2)        <------
=====================================bZIP_DOF    XXXXXXXXXXXXXXXXXXXX>MIR838                 -------
---------------TaNAC69(2)  --------->TGA1a  --------->ARR11(3)    ----------->TBP          <--------
 
caaagacccaagtccataagtaagcaagtcacgtggagtcacgtgattatcttcttcttcttcttacatataaaatgccctaactacatgttcagaatat  1291300
      --------->DREB2C(2)
      --------->DEAR3(1)
      ----------->HVH21
      --------->RAP2.3(3)
     --------->ORA47(2)
     --------->RAP2.3(1)
     --------->ATERF1(1)
     <------NtERF2
    <---------ATERF1(1)
    --------->At4g35610
    ------>NtERF2                                                                                  -
   --------->RAP2.6(2)                                                                             -
   --------->RAP2.3(2)            <-------TEIL                                                  ----
   --------->DEAR3(1)            --------->CCA1(2)                                            ------
  --------->ERF1                 --------->GLK1(2)                                          ------>ZmHOX2a(2)
  --------->MYB46(3)            <---------GATA12                                           <------ZmHOX2a(2)
  --------->ATERF1(1)           --------->GATA12                                          --------->ARR14(2)
 <---------At4g35610            --------->ARR14(2)                                        --------->ARR11(2)
 --------->At4g35610            --------->ARR11(1)                                        <---------ARR14(2)
--------DOF2                    <---------ARR11(2)                                        --------->GATA12
----ARR11(3)                    <---------ARR14(2)                <-------TEIL            <---------RVE1(2)
----ARR14(2)                   --------->KAN1                    --------->CCA1(2)        <---------ARR11(2)
--->RVE1(2)                    <---------HSFB2a(1)              <---------ARR14(2)        <---------GATA12
--->ARR11(3)                 <------ZmHOX2a(1)                  --------->ARR14(2)     <---------HSFB2a(2)
-->CCA1(1)             --------->GATA12                         <---------ARR11(2)     --------->HSFB2a(2)
---KAN1------>NtERF2   <---------GATA12                         --------->ARR11(2)    <-------------
-->RVE1(1)       --------->YAB1<---------GLK1(1)    --------->GATA12                  <---------LBD16
-GLK1(2)    *TSS<---------YAB5----------->ARR10     <---------GATA12      <---------WOX13(2)<-------
 
ctttagccgccgacttggtatcatcaaatcgaggagattcgaagaagcatggtgggatttaagaacagatacatgttaatggaagtttttctggatccgg  1291400
        --------->HSFB2a(2)
    ------>ZmHOX2a(2)
   <------ZmHOX2a(2)
  --------->ARR11(3)
  <---------GATA12
  <---------ARR14(2)
  --------->ARR14(2)
  --------->GATA12
  <---------RVE1(2)
  <---------ARR11(3)
  <---------ARR11(2)
  <---------ARR14(3)                                                  --------->RVE1(2)
  <-----------ARR10                                          ---------->DOF2
  --------->ARR11(2)                                        --------->YAB1------>ZmHOX2a(1)
  --------->ARR14(3)          <---------ICU4               <---------ATHB12     <---------WOX13(2)
-------->ANAC58              <---------YAB1              --------->WOX13(1)     --------->WOX13(2)
-------->ANAC58             --------->KAN4(2)         --------->ANAC58<---------ARR11(2)     <------
----->WRKY18(1)            --------->KAN1             --------->ANAC58<---------ARR14(2)    --------
--->LBD16                 <------ZmHOX2a(2)         ---------->DOF2   --------->ARR11(2)    <-------
----AGL1<---------HSFB2a(2)--------->YAB5        <---------HSFB2a(2)  --------->ARR14(2)   <--------
--LBD16 <---------LBD16   <---------ATHB12       --------->HSFB2a(2)  <---------ARR11(3)   ---------
 
acaaggatcttctcggagaaggaacaccgatcattcttacacaattcaatctctcgaaagcaatcaaagacagtatcctcgtcaatttcggcgagtgtgg  1291500
                                                    --------->CCA1(2)
                                                 ------->TEIL
                                              --------->ANAC46
                                            --------->YAB5
                                            --------->YAB1
                                           <---------ATHB12
                                         --------->WOX13(1)
   <-------TEIL                      --------->GATA12
---AtMYB61    --------->ARR14(2)     --------->RVE1(2)                                        <-----
->ZAT14       --------->ARR11(2)     <---------GATA12             <------ZmHOX2a(2)           <-----
--ZAT14       <---------ARR14(2)     <---------ARR11(2)          --------->ARR11(3)           <-----
-KAN1 <---------CCA1(2)              <---------ARR14(2)          ------------------------>ANAC81
>ALFIN1       <---------ARR11(2)     --------->ARR11(2)          <---------ARR11(3)          -------
 
tctaggttcgtctctcggttccttccaagtgaaatatgtgaatccaatcacgaagctatgcattgtaagatcatcaagagaagaacacagacaagtttgg  1291600
                                      <---------GATA12
                                      --------->ARR11(3)
                                      <---------RVE1(2)
                                      <---------ARR11(3)
                                   <---------MYB52(1)                         <---------ZAT14
                                <---------LBD16                               --------->REM1(2)
    --------->YAB1       <---------ARR14(2)                                <---------ANAC58
   <---------ATHB12      --------->ARR11(2)                                <---------ANAC58
 --------->WOX13(1)      <---------ARR11(2)                                <---------ANAC46
-MYB46(1)            --------->At4g35610------>ZmHOX2a(2)            <---------At4g35610
----MYB46(3)     --------->ANAC58 --------->LBD16              <-------GAMYB --------->ALFIN1
-MYB83           --------->ANAC58 <---------At4g35610         <---------MYB46(3)
-->MYB59       ---------->DOF2<-----------HVH21            ------------>AtMYB77                   --
 
ttagcaatcacattggtcaaaagcatcggaaactgtccggtgatcttaaacttgctcgatattagcggttgcatcagagcgtgtagagacacagccttga  1291700
                             ---------->DOF2
                       <---------ZAT14                      --------->YAB5            --------->ATHB12
                       --------->ZAT14                   <---------At4g35610    <------ZmHOX2a(2)
                      --------->ALFIN1        <------ZmHOX2a(1)                --------->ARR11(3)
----------->HVH21 --------->ZAT14<---------ANAC58        --------->At4g35610   <---------ARR11(3)
<----------ID1    <---------ZAT14<---------ANAC58   --------->MYB59            <---------GATA12
------->ALFIN1    <---------At4g35610     --------->DOF5.7(1)                  --------->RVE1(2)
 
agtgcgacaaggagaagtttgagcagtgtagcaaaagcttgtctgaagaggagattaggcagatgaatacttctcttgagaagatcaaactattggaaaa  1291800
<- Previous    Next ->

AGI:  At1g04630.1   
Description:  MEE4 (maternal effect embryo arrest 4). similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G33220.1); similar to unknown [Populus trichocarpa] (GB:ABK95941.1); contains InterPro domain GRIM-19 (InterPro:IPR009346)
Range:  from: 1289733    to: 1291111    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g04635.1   
Description:  EMB1687 (EMBRYO DEFECTIVE 1687); ribonuclease P. Identical to Probable ribonuclease P protein subunit 2 [Arabidopsis Thaliana] (GB:Q6AWV1;GB:O23021); similar to unnamed protein product [Vitis vinifera] (GB:CAO48546.1); contains InterPro domain Ribonuclease P-related; (InterPro:IPR002759)
Range:  from: 1291313    to: 1291994    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version