AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                        --------->AHL20(1)
                        --------->ARR11(3)
                        <---------ARR11(3)
                       <---------AHL20(2)
                       --------->AHL12(3)
                     --------->AHL20(2)
                     --------->AHL12(3)
                     <---------AHL20(2)
                     <---------AHL12(3)
                   --------->AHL20(2)
                   <---------AHL20(2)
                   --------->AHL12(3)
                 <---------AHL12(3)
                 --------->AHL12(3)
                 --------->AHL20(2)
                --------->ARR11(3)
                <---------ARR11(3)
        <----------DOF2<---------AHL12(3)
       <---------DOF5.7(1)                                                                      ----
     ---------->ID1<---------AHL12(3)                            <---------GLK1(1)         <--------
------>RAV1(2)  <---------AHL20(1)                          --------->DOF5.7(1)       --------->KAN1
-----At4g35610 <---------KAN1                             ---------->DOF2           --------->YAB1
-----GT1------>ZmHOX2a(1)--------->KAN1       <----------DOF2    --------->GLK1(1) <---------ATHB12<
 
ctgtttgtgtccttttgaatatatatatatattcggctctgttcatatactttagtagcacaaaagagagttcccatcttgctccagtcatgttcttttg  186800
                                                          <-----------RAV1(1)
                                                  <---------ANAC46
                                                  <---------ANAC58
                                                  <---------ANAC55(1)
                                   <---------ANAC46 <---------ZAT6
   <----------DOF2       <-------GAMYB            <---------ANAC58
------>ID1              <---------ANAC58      --------->ARR11(3)                        <----------DOF2
--DOF2                  <---------ANAC58  --------->DOF5.7(1)                          <---------DOF5.7(1)
----------DOF2       <-----------RAV1(1)---------->DOF2  <---------YAB1           <---------KAN1
 
ttctttcttttctcaagtctgtctatgtcgttgctcttgtgtagaaagagatttcgtgttattgttgttgttgtcaaacgctggagtttgtctttcggtt  186900
                                                                                       --------->ANAC58
                                                                                       --------->ANAC58
                                                                                  <----------ID1
                                                                               <---------YAB1
                                                                             --------->ATHB51
                                                                             -------->ATHB1
                                                                             <---------ICU4
                                                                             --------->YAB5
                                                                            --------->AHL25(2)
                                                                            --------->AHL25(1)
                                                                            <---------AHL20(3)
                                                                            <---------AHL25(1)
                                                                            <---------AHL25(2)
                                                                            --------->AHL20(3)
                                                                            --------->AHL25(3)
                                                                            <---------ATHB51
                                                                            <---------AHL20(2)
                                                                            --------->AHL12(1)
                                                                            --------->ICU4
                                                                            <---------AHL12(1)
                                                                            --------->AHL20(2)
                                                                           --------->AHL12(2)
                                                                          <---------AHL12(2)
                                                                          --------->AHL12(2)
                                                                         <---------AHL20(2)
                                                                         --------->AHL20(3)
                                                                         <---------AHL12(3)
                                                                         --------->AHL20(2)
                                                                         --------->AHL20(1)
                                                                         <---------AHL25(3)
                                                                         <---------AHL25(2)
                                                                         <---------AHL20(3)
                                                                         --------->AHL25(2)
                                                                         <---------AHL25(1)
                                                                         --------->AHL25(1)
                                                                        <---------AHL20(2)
                                                                        --------->AHL12(3)
                                                                        --------->AHL12(1)
                                                                        --------->AHL20(2)
                                                                        <---------AHL12(3)
                                                                        <---------AHL12(1)
                                                   <---------ARR14(2)   --------->AHL25(1)
                                       <---------At4g35610              <---------AHL25(3)
                                       ----------->RAV1(2)              --------->AHL25(3)
                                       --------->At4g35610       ----------->GT1<-----------GT1
                                     <-----------GT1           --------->ICU4<---------AHL25(3)
                             <-------TEIL          --------->ARR11(2)   <---------AHL25(2)
         --------->ICU4      ------->TEIL          <---------ARR11(3)   <---------AHL25(1)
     <------ZmHOX2a(1)    <---------KAN1           --------->RVE1(2)    --------->AHL25(2)    ------
    ----------->GT1      <---------KAN4(2)         --------->ARR14(2) --------->WOX13(2)    <-------
  <-----------RAV1(2)    --------------->AtSPL8    --------->GLK1(2)<---------AHL20(2) --------->ANAC46
<-----------HVH21        <---------------AtSPL8    <---------ARR11(2) <---------WOX13(2)    --------
 
tctggtcaggaaataatgtggaatagggaatgtacatgtttcacctgtattcagtatctgtttgcaattagtaaattaaattattacaacaagccaagtg  187000
                                                                                <---------WOX13(2)
                                                                        <---------AHL25(3)
                                                                        --------->ATHB12
                                                                        --------->ATHB51
                                                                        <---------ICU4
                                                                        -------->ATHB1
                                                                       --------->AHL12(1)
                                                                       <---------AHL25(2)
                                                                       --------->ICU4
                                                                       --------->AHL25(3)
                                                                       --------->AHL25(2)
                                                                       <---------AHL12(1)
                                                                       <---------AHL20(2)
                                                                       <---------AHL25(1)
                                                                       --------->AHL20(1)
                                                                       <---------ATHB51
                                                                       <---------YAB1
                                                                      --------->AHL12(3)
                                                                      --------->AHL25(2)
                                           <---------LBD16            <---------AHL25(2)
                                     <---------DOF5.7(1)              <---------AHL12(2)
                                  <---------ANAC46                    <---------AHL12(3)
              --------->YAB1      --------->O2                        --------->AHL12(2)
             <---------YAB1       <---------bZIP60(1)                <---------AHL12(2)
       <---------ANAC46           <---------O2                       --------->AHL12(2)
      <------NtERF2               <---------ANAC58                  --------->AHL20(2)
     ------>NtERF2                <---------ANAC58                  --------->AHL25(3)
    --------->DEAR3(1)            <---------bZIP60(2)               --------->AHL12(1)
   --------->ATERF1(1)            --------->bZIP60(1)               --------->AHL25(2)
   <------NtERF2<---------YAB1    --------->TGA2(1)                 --------->AHL20(3)
  <---------RAP2.3(1)             <---------TGA2(1)                 <---------AHL20(3)
  <---------ATERF1(1)            ----------->STF1                   <---------AHL20(2)
 <---------DEAR3(1)             <---------TGA2(2)                   <---------AHL25(2)
--->ALFIN1   <---------YAB5    ----------->TGA1                     --------->AHL25(1)  <---------AHL20(2)
--O2<---------DEAR3(1)         ----------->HVH21    <---------KAN1  <---------AHL25(1) --------->AHL20(2)
->O2<---------ANAC46 <-----------HVH21    <---------LBD16           <---------AHL12(1) <---------AHL20(2)
 
gaagacggcgtcgtttatcataaatgtcaaaccgatgacgtcttatcgggggagcatgagcattggactaaaaaattattgtcaatttgtttaaattgta  187100
               <---------YAB1
              <---------AHL12(3)
              <---------AHL12(2)
              <---------AHL20(3)
              <---------AHL25(2)
              --------->AHL25(2)
              --------->AHL20(3)
             --------->YAB1
             -------->ATHB1
             <---------ICU4
             <---------AHL25(3)
            <---------YAB1
            <---------AHL25(1)
            <---------AHL12(1)
            --------->AHL12(1)
            --------->AHL25(1)
            <---------AHL12(3)
            --------->AHL20(1)
            <---------AHL20(2)
            --------->AHL20(2)
            <---------AHL25(2)
            --------->AHL25(2)
            --------->ICU4
            --------->AHL25(3)
           <---------AHL20(3)                                            --------->YAB5
           --------->AHL25(2)                                            <---------ICU4
           <---------AHL12(2)          <---------WOX13(2)                --------->YAB1
           <---------AHL25(2)          --------->WOX13(2)         --------->TOE1(3)
           --------->AHL12(2)       <---------MYB52(1)            --------->TOE2(3)
           --------->AHL20(3)<-----------GT1                    ------->TEIL                      <-
  <---------PCF2--------->YAB1<-----------GT1        <-----------GT1    <---------ATHB12--------->RVE1(2)
  --------->ZAT18 <---------YAB1   <---------DOF5.7(1)     <------------CBF--------->ICU4 --------->YAB1
 
ttttgggccctgaaaattattataaatgaaatttagccccttaattttgtaagagtttacaacattgaaccctaaatcattatgttcccaaaatcaaaat  187200
                                                                                         ------>NtERF2
                                                                                        --------->DEAR3(1)
                                                                                       <------NtERF2
                                                                                       --------->ATERF1(1)
                                                                                      ------>NtERF2
                                                                                      <-----------HVH21
                                                                                      <---------ATERF1(1)
                                                                                     --------->O2
                                                                                     --------->DEAR3(1)
                                                                                     <---------DEAR3(1)
                                                 <---------DEAR3(1)                  <---------O2
                                                ----------->RAV1(2)              <---------At4g35610
                                         <-------TEIL                            --------->DEAR3(2)
                                        --------->ARR14(1)                       <---------LBD16
                                        <------ZmHOX2a(2)                        --------->At4g35610
                                       --------->GATA12                       --------->ATERF1(1)
                                       <---------ARR14(2)                     <------NtERF2
                                       --------->ARR11(2)                     ----------->HVH21
                                       --------->ARR11(3)                    <-----------HVH21 -----
                                       --------->AGP1----------->RAV1(1)     <---------ATERF1(1)
                                       <---------GATA12                      <---------RAP2.6(3)
                                       --------->RVE1(2)                     <-----------TGA1  <----
                                       <---------ARR11(2)                   --------->ANAC46--------
                                       --------->ARR14(2)                   --------->RAP2.6(2)<----
                                       <---------ARR11(3)                   --------->DEAR3(1) -----
                                      --------->KAN1----------->HVH21     ------>MYB46(1)<---------ATERF1(1)
                             --------->At4g35610=================RAV      --------->At4g35610<------
                           =====================HOX2a_HOX2a               --------->ZAT2<---------DEAR3(1)
                           <------ZmHOX2a(1) --------->SPL7(1)            ------>MYB83<---------RAP2.3(1)
                           ====================HOX2a_HOX2a              --------->MYB46(3)<------NtERF2
                        <------ZmHOX2a(1)------>ZmHOX2a(2)            ------>NtERF2 --------->RAP2.3(1)
          *TSS          ========================HOX2a_HOX2a    <---------O2 --------->RAP2.3(3)-----
    ------>ZmHOX2a(1)   =======================HOX2a_HOX2a     <---------ALFIN1  --------->ATERF1(1)
--------->ANAC46       --------->DOF5.7(1)  <---------MYB52(1) --------->O2 --------->RAP2.3(2)-----
----------GT1 <---------ANAC46       ----------->ARR10         --------->bZIP60(2)--------->DEAR3(1)
 
ttcactcctcgagagtagcgagaagaaggaggagatgagcaagatccgttcgtctgcgacaatgccacatcgcgaccagccgtcaccggcgtcgcctcac  187300
                                                             <---------ANAC46
                                                         <---------ANAC58
                                                         <---------ANAC58
                                                         <---------ANAC46          --------->RAP2.3(2)
                                                      <<<<<<<<<MYB2              --------->At4g35610
                                                     <-------GAMYB               --------->ZAT2
     --------->ANAC46                               <---------DEAR3(1)         ---------->CDC5
     --------->ANAC58                              <------NtERF2             <-----------HVH21
     --------->ANAC58                             --------->LBD16     <---------ANAC55(2)
   --------->ZAT6         --------->ZAT18         <---------ATERF1(1) --------->ANAC55(2)
---->ANAC46               <---------ZAT18         ------>NtERF2 <---------ANAC46 <---------At4g35610
-----O2--------->ZAT14    --------->ZAT14        <---------DEAR3(1)<---------ARR11(2)
--->HVH21            <---------ARR14(2)          --------->ATERF1(2)  --------->ANAC46             -
-----TGA1a          <------ZmHOX2a(1)           --------->ATERF1(1)<---------ARR14(2)           ----
---->O2<---------ZAT14 --------->KAN1           <---------LBD16<------NtERF2<---------At4g35610-----
---ALFIN1--------->At4g35610                   <---------ATERF1(1) --------->ARR11(2)      ---------
---->bZIP60(1)<---------ZAT14    --------->ANAC58<---------ATERF1(2)<---------KAN1 --------->RAP2.6(2)
---->TGA1a    --------->ZAT14    --------->ANAC58--------->DEAR3(1)--------->ARR14(2)   --------->DEAR3(1)
 
gtcgttacactcaactgtatagaggattgtgcgctcgagcaagactccctcgccggcgttgctggtgtcgaatacgtcccgctcagccgcatcgccgatg  187400
                --------->ABI4(1)
                ------>NtERF2
               --------->DREB2C(2)
               --------->DEAR3(1)
               <---------ALFIN1
               ------->GAMYB
              --------->ATERF1(1)
              --------->DEAR4(2)
              --------->DEAR3(2)
              --------->MYB46(3)
              <------NtERF2
             --------->ABI4(1)
             <---------ATERF1(1)
             ------>NtERF2
            --------->DEAR3(1)
            --------->AtMYB61            ------->TEIL
            <---------ALFIN1             <---------ARR11(1)
           --------->MYB46(3)            <---------ARR11(2)
          <---------ATERF1(1)            --------->RVE1(2)
          ------>NtERF2                  --------->ARR11(2)
         --------->ANAC58                --------->ARR11(3)       --------->ATERF1(1)
         --------->ANAC46                <-----------ARR10       ------>NtERF2
        --------->ZAT18                  <---------ARR11(3)      <---------ATERF1(1)
        --------->SPL7(1)                --------->ARR14(2)     --------->RAP2.3(3)
      --------->ARR14(2)                 <---------ARR14(2)     --------->DEAR3(1)
      <---------ARR14(2)                <---------ARR14(1)   --------->DEAR3(1)
  ===============================HOX2a_HOX2a      <-------PIF5 --------->ORA47(2)             <-----
  <------ZmHOX2a(2)                     <---------KAN1       --------->ANAC46                 <-----
 --------->GATA12                       <---------CCA1(2)  <---------ALFIN1          --------->KAN4(2)
 <---------GATA12                     --------->ANAC55(2) ---------->CDC5           --------->KAN1
 --------->ARR11(3) <---------MYB52(1)<---------ANAC58 --------->ZAT2            <---------ZAT2
-------->DOF5.7(1)--------->DEAR3(1)  <---------ANAC58 --------->At4g35610       --------->ZAT2    <
------------------->TaNAC69(2)        <---------ANAC55(2) <---------WRKY38(1)    --------->At4g35610
------>GT1<------NtERF2               <---------ANAC46 <---------At4g35610       <---------At4g35610
>DEAR3(1)--------->ANAC58 ------>ZmHOX2a(1)       ------->PIF5------->GAMYB------>ZmHOX2a(1)------>NtERF2
 
gtaagatcgagtccgccaccgccgttctcctccattccctcgcgtatcttccacgagcagctcaacgccgactccgtcctcaccagctcattctctgcct  187500
                                    --------->ORA47(1)
                                    ------>NtERF2
                                   --------->DEAR4(1)
                                   ----------->HVH21
                                   --------->DEAR3(1)
                                  --------->DEAR3(2)
                                  --------->RAP2.3(1)
                                  --------->ORA47(2)
                                  --------->ATERF1(1)
                                  <------NtERF2
                                 <---------ATERF1(1)
                                 <---------At4g35610
                                 --------->At4g35610
                                 ------>NtERF2
                                 --------->ABI4(1)                                               <--
                                <---------DEAR3(1)                                              <---
                                --------->DEAR3(1)                                          --------
                                --------->ATERF1(2)                                        <--------
                                --------->RAP2.3(2)                                        ---------
                                <---------ATERF1(2)                                        <--------
                                --------->RAP2.3(3)                                        ---------
                               --------->RAP2.3(1)                                       --------->LBD16
         ------>ZmHOX2a(2)     --------->DEAR4(2)                             --------->LBD16   <---
   <---------At4g35610         --------->ERF1                   --------->ARR14(2)      <---------ANAC46
   --------->At4g35610         --------->ATERF1(1)              <---------ARR11(3)     <---------LBD16
   <---------ZAT2             <---------ATERF1(1)               <---------RVE1(2)<------ZmHOX2a(1)
----ANAC58         <---------ARR11(2)       <---------GLK1(1)   <---------ARR14(2) --------->GLK1(1)
----ANAC58--------->ZAT18    --------->ANAC46    ------>NtERF2  <---------ARR11(2) <---------GLK1(1)
---------RVE1(2)   <---------GATA12--------->DREB2C(2)     --------->AtLEC2  --------->DEAR3(1) <---
 
tggctctgctgatcgcgctgtcgattcgactctcgccgccgacctaggtctccgacttgtccatgtagatacttcacgagccgaggaaatcgcggatacc  187600
                                                                            --------->GATA12
                                                                            <---------GATA12
       --------->KAN1                                                  <---------ANAC46
    <---------At4g35610                                              <------MYB83
-------MYB52(1)                                               <------NtERF2 --------->ARR14(2)   <--
------RAP2.6(3)                     --------->KAN1           <---------SPL7(1)------>ZmHOX2a(2) <---
->GLK1(1)                         <---------KAN1       --------->ARR11(2)   <---------ARR14(2)  ----
-ARR14(2)                     --------->ANAC58   --------->ANAC58    <---------DEAR3(2)         ----
>ARR11(2)                     --------->ANAC58   --------->ANAC58    <------MYB46(1)      <---------
-ARR11(2)                  <---------SPL7(1)   <---------ALFIN1     <---------DEAR3(1)   <---------DOF5.7(1)
>ARR14(2)<---------YAB1    ----------->HVH21  <---------REM1(2)    <--------P<------ZmHOX2a(2) <----
--------HVH21          ----------->HVH21    ----------->HVH21------>NtERF2  --------->ARR11(2) <----
--------TGA1         ------>ZmHOX2a(1)      --------->ANAC46<---------ANAC46<---------ARR11(2)<-----
 
gtcatggcgctcatccttggactccttcgacggacgcatttactctcgcgacacgctctatcggcgtctggttggctcggatcgcttcagcctctttgcc  187700
<- Previous    Next ->

AGI:  At1g01500.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G19400.1); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G19400.2); similar to unknown [Picea sitchensis] (GB:ABK24253.1); contains domain PTHR10996:SF1 (PTHR10996:SF1); contains domain PTHR10996 (PTHR10996)
Range:  from: 185133    to: 186923    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g01510.1   
Description:  AN (ANGUSTIFOLIA). similar to HPR (HYDROXYPYRUVATE REDUCTASE), glycerate dehydrogenase/ poly(U) binding [Arabidopsis thaliana] (TAIR:AT1G68010.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39640.1); similar to angustifolia [Ipomoea nil] (GB:BAC58020.1); similar to hypothetical protein OsI_009584 [Oryza sativa (indica cultivar-group)] (GB:EAY88351.1); contains InterPro domain D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding; (InterPro:IPR006140); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 187211    to: 190056    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version