AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                            --------->AHL20(1)
                                                                            <---------AHL25(1)
                                                                            <---------ARR11(3)
                                                                            --------->AHL25(2)
                                                                            --------->AHL25(1)
                                                                            <---------AHL20(3)
                                                                            <---------AHL20(1)
                                                                            --------->AHL20(2)
                                                                            <---------AHL20(2)
                                                                            --------->AHL20(3)
                                                                            <---------AHL25(2)
                                                                            --------->AHL25(3)
                                                                            --------->AHL12(1)
                                                                <---------AHL12(1)
                                                                --------->AHL12(1)
                                                               <---------AHL25(2)
                                                               --------->AHL25(2)
                                                               <---------AHL25(1)
                                                               --------->AHL12(1)
                                                               <---------AHL25(3)
                                                               <---------AHL12(2)
                                                               --------->AHL12(3)
                                                               <---------AHL12(1)
         --------->ANAC58                                      --------->AHL25(1)
         --------->ANAC58                                     --------->AHL25(3)
      <---------ARR11(2)                                      <---------AHL12(3)
      <---------ARR14(2)                                      --------->AHL12(3)
      --------->ARR11(2)                      --------->At4g35610           <---------AHL12(1)
      --------->ARR14(2)          <---------YAB1              --------->AHL20(2)
     <------ZmHOX2a(1)          --------->AHL20(2)            --------->AHL25(1)
 --------->DOF5.7(1)            --------->YAB1<---------At4g35610           --------->ARR11(3)
--------->DOF2     <---------GATA12         <--------P        <---------AHL25(1)
-------AHL20(2)    <---------ARR11(3)   --------->DOF5.7(1)   <---------AHL25(2)     --------->DOF5.7(1)
--AHL25(2)         --------->ARR11(3)  --------->DAG2   <---------ZAT6      <---------AHL25(3)
--AHL20(3)         --------->GLK1(2)   --------->DOF5.7(1)    --------->AHL25(2)  ---------->DOF2
->AHL25(2)         <-----------ARR10  --------->DOF5.7(1)    --------->AHL12(2)  <---------AHL20(2)
->AHL20(3)         --------->RVE1(2)  ---------->DOF2 ----------->GT1      <---------KAN1       <---
 
taaaaagaggaaacgaaacaaaaatctagccacaattataaaaaagggtagatgaattagtgaaaaaaaattcaaagaatatattaaaagaagggaagaa  13300
                 <---------ANAC58  --------->YAB1
               --------->ARR11(3)  --------->AHL20(2)
         --------->YAB1           <---------YAB1                                              <-----
       --------->RVE1(2)      <---------DAG2                                                <-------
  ----------->GT1<---------ANAC58--------->AHL20(2)                                <----------DOF2
---------->DOF2<---------ARR11(3)--------->AHL20(3)                  --------->ARR11(3)     <-------
--------->DOF5.7(1)  <---------AtMYB61                               <---------RVE1(2)      <-------
-------ID1 ---------->DOF2    --------->TOE2(3)                --------->ARR11(3) <---------DOF5.7(1)
 
ggaaaaagaaaatcaaaagttcttgtggtctcaccttataatataagagagagagagggagagagagatgttgatattgaagtcttctttctcttgctgg  13400
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                  <-
                        <---------WRKY18(1)                                                       ==
                       --------->WRKY12                                                        -----
                       --------->WRKY38(1)                                                     -----
                       --------->WRKY45                                                       ------
               <-----------GT1                                                                <-----
            --------->GATA12                                                                 <------
            <---------ARR11(3)                                                               <------
       <---------ANAC46----------->HVH21                                                    <-------
  <---------KAN1     <----------DOF2      <------ZmHOX2a(1)                             <----------DOF2
----MYB46(3)<---------GLK1(2)     <---------WOX13(2)                                 --------->ARR11(3)
--ANAC46    --------->ARR11(3)   --------->AHL12(1)          --------->GLK1(2)       <---------ARR11(3)
--ANAC58    <---------RVE1(2)    <---------AHL12(1)         <---------GLK1(2)       <---------CCA1(2)
--ANAC58    <---------GATA12 --------->AtLEC2   <---------YAB1                     ------->TEIL-----
 
ttcgattgtttcttagattttcttctttgaccatgaaaatttagaggaaatatgaaaaccctagaatcggaagaaaactatatatgtatatctttccgtt  13500
                                                                                            <-------
                                                                                           <--------
                                                                                     ------>ZmHOX2a(2)
                                                                                    <---------GLK1(1)
                                                                                    <---------KAN1<-
                                                                                    <------ZmHOX2a(2)
                                                                                    --------->GLK1(1)
 --------->AHL20(2)                                                                <---------GATA12
-------------->AGL15                                                               <---------AGP1<--
----------DOF2                                                                     <---------ARR14(2)
---------------AGL15                                                               --------->GATA12
----------------AGL3                                                               <---------ARR14(3)
========================================================================MADS_MADS  --------->RVE1(2)
---->WRKY45                                                                        --------->GLK1(2)
---->WRKY38(1)              --------->DOF5.7(1)                                    --------->ARR11(3)
--->DOF5.7(2)              --------->DOF5.7(1)                                     --------->ARR11(2)
----MYB52(1)              ---------->DOF2    <------ZmHOX2a(1)     <---------ANAC58<---------ARR11(2)
-GAMYB               ---------->DOF2      <---------ICU4           <---------ANAC58<-----------ARR10
---At4g35610      --------->ANAC58       <---------ATHB12      <---------ANAC58    <---------ARR11(3)
--ANAC46          --------->ANAC58 --------->ANAC58            <---------ANAC58    --------->ARR14(2)
---->WRKY12       <---------TOE2(3)--------->ANAC58   <-----------------AGL3      <------ZmHOX2a(1)
 
gactttatatagaatgaaatcaaggaaagaaaagagctaagcaaatcaggacttagaactcaaattgggttcttgccaaacaagaggatctctctctttc  13600
                                                                                               -----
                                --------->GLK1(2)                                              <----
                               <---------GLK1(2)                                        <---------ANAC58
                               <---------RVE1(2)                                        <---------ANAC46
                         <---------ANAC46                                           --------->KAN1
                         <---------ANAC58                                          <---------KAN1
                         <---------ANAC58                                      <---------ANAC46<----
---DOF2                 <------NtERF2                                     <------MYB83  <---------ANAC58
-DOF5.7(1) ----------->GT1    --------->KAN1                              <------MYB46(1)      <----
---------DOF2         <---------RAP2.6(2)                                <---------------AtSPL8-----
-------DOF5.7(1)--------->DOF5.7(1)                                     <---------WOX13(1)   -------
 
tctttatgaagatgaagaaaaaatggtggcttgagattcttgatagagtttcaagacttagagagagagagcgagattggtaccgagtaatgcgtagggg  13700
       --------->CCA1(2)
      <---------RVE1(2)
     --------->YAB1       <---------At4g35610
    <---------YAB5        --------->At4g35610
   <---------WOX13(1)<---------O2
<---------ATHB12     --------->TGA1a      <---------WOX13(2)                          <----------DOF2
<---------YAB1       <---------TGA1a      --------->WOX13(2)                      --------->RVE1(1)
->NtERF2             <---------ANAC55(2)<---------YAB1                           <---------ARR11(3)
-----PCF5            ===========================bZIP_DOF           <------------CBF  <---------DOF5.7(1)
-----TCP20           --------->O2    ------>ZmHOX2a(1)        <----------DOF2    --------->ARR11(3)
-----TCP15(1)*TSS<-----------HVH21   <----------DOF2         <---------DOF5.7(1) --------->GLK1(2)
---->PCF2   --------->ARR11(2)      <---------DOF5.7(1)<---------KAN1            --------->RVE1(2)
-->ATERF1(1)<---------ARR11(2)    ---------->ID1      --------->WOX13(2)        <---------GLK1(2)
 
cccatgaatgatatggttcgggtcatgtgagcttcttgtccttttcattaggcttcgaattagctctttgtattgaaatttcaaaatctctttatacata  13800
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                      <---------------AGL15                    -----
                                                      --------------->AGL15                    <----
                                               <---------YAB5                                  -----
                                      --------->RVE1(2)                                     ------>MYB46(1)
                                      --------->GLK1(2)          <---------KAN1             ------>MYB83
                                      --------->ARR11(2)        <---------ARR14(2)        <---------MYB46(2)
                                      <---------ARR11(2)    --------->YAB5                --------->TOE2(3)
                              <---------WOX13(2)<---------DOF5.7(1)                       <---------MYB59
                              --------->WOX13(2)<---------ICU4  --------->ARR14(2)       <---------ANAC55(2)
                      <---------DEAR3(1)   <---------MYB52(1)   <---------ARR11(2)       --------->ANAC55(2)
         --------->YAB5  ----------->GT1 ----------->GT1   <---------YAB5              <-----------GT1
     ------->TEIL  --------->ETT(2)   <---------ARR14(2)   <---------ATHB12     <---------DOF5.7(1)
 ------->TEIL      <---------ETT(2)   --------->ARR14(2)   --------->ICU4      <----------DOF2 -----
 
tgtgtatgtatatgtttagttgtcgacggtgttaatttgagaatccgttaatcttttctctaatgagtatatgtgtgtgtttcttttttgttacctaatt  13900
            <---------AHL25(1)
            --------->AHL25(1)
            --------->AHL25(2)
            <---------AHL25(2)
            <---------AHL12(1)                                                              <-------
            --------->AHL12(1)                           <-------GAMYB                     ---------
            --------->AHL20(3)                          <---------MYB46(3)                 ---------
            --------->AHL20(2)                          <------MYB46(1)                    <--------
----->AHL12(3)                                          --------->MYB55(2)                 <--------
------AHL25(1)                                      <-----------RAV1(1)                    ---------
------AHL25(2)                                   -------->HAHB4                            ---------
----->AHL25(1)                                   -------->ATHB1                            <--------
------AHL12(3)                                   --------->ATHB51                          ---------
------AHL20(2)                                   --------->ATHB12                          <--------
------AHL25(3)                                   <---------ICU4                            ---------
----->AHL25(2)                                   <---------AHL20(2)                        <--------
---->AHL12(1)                                    <---------AHL25(3)                       <---------YAB5
---->AHL12(3)                                   --------->ICU4                            <---------YAB1
-----AHL20(2)                         <----------DOF2   <------MYB83                     <---------WOX13(2)
-----AHL20(1)                     ------->TEIL  <---------ATHB12                         --------->WOX13(2)
-----AHL12(1)                  <---------ANAC55(2) <---------YAB1    --------->YAB1      --------->AHL20(3)
---->AHL25(1)                <---------AHL12(1) <---------ATHB51     <---------AHL20(2)  <---------AHL20(3)
-----AHL25(1)                --------->AHL12(1) <---------YAB5       <---------AHL25(1) <---------ICU4
-----AHL25(3)               --------->ICU4      <---------YAB1       --------->AHL20(2) --------->YAB1
---->AHL25(3)              <---------WOX13(2)  --------->AHL12(2)  --------->WOX13(2)   --------->YAB5
-----AHL25(2)              --------->WOX13(2)  <---------AHL12(2)  <---------WOX13(2)  <---------AHL20(2)
---->AHL25(2)         --------->RVE1(2)       <---------ICU4     --------->ICU4        <---------YAB1
---->AHL20(2)  <-----------GT1 <---------YAB1--------->ICU4   --------->ZAT6         --------->YAB1
 
tttttttaaaaacaattttttctattatctaattatgtatgctttctactaattattgttggttagcactaattaaaacaatttgaatttataattatat  14000
                                   <---------KAN1
        --------->MYB111(1)       --------->ARR11(2)
        --------->MYB46(2)        <---------ARR14(2)
        --------->MYB52(2)        --------->ARR14(2)                              ------>ZmHOX2a(1)
--AHL25(3)                        <---------ARR11(3)                           ------>ZmHOX2a(1)
>AHL20(2)                         <---------ARR11(2)                        <-----------GT1
>YAB1 <---------MYB52(1)      <-----------RAV1(2)                       <---------DOF5.7(1)
-AHL12(1)               --------->LBD16                                <----------DOF2
-AHL20(2)              <---------LBD16  ------->TEIL                <-----------GT1
>AHL12(1)             <---------LBD16<---------ANAC55(2)         <---------AHL25(1)
>AHL12(3)         ----------->HVH21--------->GLK1(1)             <---------AHL20(2)
-AHL20(3)         ------->GAMYB  <------ZmHOX2a(1)               --------->AHL12(3)
>AHL25(1)        <------------AtMYB77--------->ANAC55(2)         <---------AHL20(3)
-AHL25(1)        <---------MYB52(2)--------->CCA1(2)--------->TOE2(3)---------->ID1                <
>AHL20(3)      <-----------GT1--------->YAB1      -------->P     --------->AHL20(3)     --------->TOE2(3)
-AHL12(3)<---------WOX13(2) --------->GLK1(2)<-----------GT1  ------->TEIL <-----------GT1      ----
 
atagtttttgttagttagtaactgacccgggaatcaggatatgtatttatactaacctctatatgtatttttttcttttttcctcctctaacctatatgt  14100
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                <---
                                                                                               <----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                          --------->ANAC46    <-----
                                                                          --------->ANAC58    ------
                                                                          --------->ANAC58  <-------
                                                                         ------->TEIL     <---------AHL20(2)
                                                               <---------AHL25(3)         <---------AHL25(1)
                                                              --------->AHL20(2)          --------->AHL25(1)
                                                              <---------AHL12(3)          --------->AHL20(2)
                                     --------->KAN4(1)        <---------AHL25(1)          --------->AHL25(2)
                                     <---------KAN4(1)      --------->AHL12(3)            <---------AHL20(1)
                                     <---------AHL12(1)     <---------AHL12(3)            --------->AHL20(3)
                                     --------->KAN1         <---------AHL20(3)            <---------AHL25(3)
                                     --------->HSFB2a(1)    --------->AHL20(3)            --------->AHL20(1)
                                     <---------HSFB2a(1)  --------->AHL20(2)              <---------AHL20(3)
                                     <---------KAN1       <---------AHL12(3)             --------->AHL25(3)
                                     --------->AHL12(1)   --------->AHL12(3)   --------->ARR14(2)  -
                          --------------->AGL15           <---------AHL20(2)   <---------ARR14(2) --
                          <---------------AGL15    --------->ANAC58   --------->AtLEC2   --------->AHL20(2)
  <---------HSFB2a(2)    ----------------->AGL3    --------->ANAC58 <---------AtLEC2   --------->TOE2(3)
  --------->HSFB2a(2)  <-----------GT1--------->KAN4(2)   <---------AHL25(1)  <---------CCA1(2)<----
-----------GT1      <---------DOF5.7(1)          ---------->DOF2--------->CCA1(2)   <-----------GT1-
--->TEIL        ------->TEIL        <---------KAN4(2)     --------->AHL25(1)  <---------KAN1--------
 
atttaccagaaaacaaatgcacattttttccatgtatagaatattctattacaaaagcaatataaatatatgcatgcacgcatattttcacattaaatta  14200
<- Previous    Next ->

AGI:  At1g01030.1   
Description:  NGA3 (NGATHA3); transcription factor. similar to NGA1 (NGATHA1), transcription factor [Arabidopsis thaliana] (TAIR:AT2G46870.1); similar to AT1G01030 [Arabidopsis lyrata subsp. petraea] (GB:AAT72472.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340)
Range:  from: 11649    to: 13714    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version